ID: 997170425

View in Genome Browser
Species Human (GRCh38)
Location 5:131713696-131713718
Sequence CTGTTTAATTGCATGTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997170425 Original CRISPR CTGTTTAATTGCATGTATAT TGG (reversed) Intronic
903099945 1:21020621-21020643 CTGATTCACTGCATGTAAATAGG - Intronic
904119263 1:28185872-28185894 CTATTTAATTGCTTGTTTATAGG - Intronic
905297871 1:36965815-36965837 ATGTGTAATTGCTTGTAAATTGG - Intronic
907170003 1:52453922-52453944 CTTGTTCATTGCATGTATCTGGG - Intronic
907630018 1:56071355-56071377 TTGTTGAATAGCATGTAAATTGG + Intergenic
908101351 1:60794483-60794505 TTATTTAATTGAAAGTATATTGG - Intergenic
909159807 1:72132146-72132168 CTATTTATGTGCATGTATACTGG - Intronic
909866288 1:80676341-80676363 CTGTTTCTTTGAATGTATAATGG - Intergenic
910877323 1:91889256-91889278 TTGTATAAAGGCATGTATATCGG - Intronic
916912233 1:169363377-169363399 TTGTTTAATTGTATATGTATTGG - Intronic
921894540 1:220386074-220386096 CTGCTTATTTTCCTGTATATGGG + Intergenic
922279859 1:224113612-224113634 TTGTATGATTGCATTTATATAGG - Intergenic
1063830398 10:9946045-9946067 CTTCTTAATTTCATATATATGGG + Intergenic
1068873513 10:61971825-61971847 ATTTTTAATTGAATATATATTGG + Intronic
1069260632 10:66390671-66390693 CTTTTTAGTTTCATGTATGTTGG - Intronic
1069521608 10:69125738-69125760 CTGTTTCATTGCTTGTGTATGGG + Intronic
1071098128 10:82003115-82003137 CTGATTAATTGCATGTGCAAGGG + Intronic
1071279627 10:84088547-84088569 CTGTTTATTTACATTTATAATGG - Intergenic
1072935919 10:99713318-99713340 CTGTTTAATTTCATCTCGATGGG + Intronic
1074407933 10:113196007-113196029 CCATTTAATTGCATTTATATTGG + Intergenic
1075876833 10:125814548-125814570 CTGTTCAATTGCATTTATTAAGG + Intronic
1079901383 11:26190951-26190973 GTGTTTATTTGTATGCATATTGG + Intergenic
1080009060 11:27439294-27439316 CTGTATAATTCCATTCATATAGG - Intronic
1081038070 11:38175465-38175487 CAGTTTAATTGCTTTTATGTTGG - Intergenic
1081350047 11:42040607-42040629 GTGTTTAAATGCATGCATTTTGG + Intergenic
1085697364 11:78716405-78716427 CTGTTTAATTGTCTGTCTTTTGG + Intronic
1086745546 11:90422399-90422421 CTTTTTAATTTTATGTACATGGG - Intergenic
1086798401 11:91138472-91138494 TTGTTTAATTTCCAGTATATAGG - Intergenic
1086820907 11:91434586-91434608 CTATATAATTCCATTTATATGGG - Intergenic
1087465975 11:98506277-98506299 CAGTTTATTTGCATATTTATAGG + Intergenic
1088231223 11:107675517-107675539 CTGATTAATAGCATGTAGGTGGG + Intergenic
1090697611 11:129264156-129264178 CAGTATAATCCCATGTATATGGG + Intronic
1091053053 11:132392131-132392153 CTGTTTACTTGTCTGTATATAGG + Intergenic
1091612023 12:2018885-2018907 CAGTTTATTTGCATGTTTGTAGG - Intronic
1095170171 12:39025751-39025773 CTGTTTGAGTACATTTATATGGG + Intergenic
1097083742 12:56452257-56452279 CTGTATGATTACATTTATATGGG - Intronic
1098818297 12:75196239-75196261 CTGATTTATAGTATGTATATTGG + Intronic
1099869585 12:88329958-88329980 CTGTTTAATTGCTTGCCTGTAGG - Intergenic
1100617865 12:96245286-96245308 CAGTTGAATTTCATGTCTATTGG + Intronic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1104628917 12:130382762-130382784 CTGTTTAATTGTTGTTATATTGG + Intergenic
1105394569 13:20017797-20017819 TTTTTTAAGTGCATGTGTATTGG + Intronic
1107147627 13:37075782-37075804 CTGTTTAGATGCATGTAAAATGG + Intergenic
1107406516 13:40119296-40119318 CTTTTTCATTGCATGTATATAGG - Intergenic
1107994482 13:45847177-45847199 CTGTTTAATAGCTGGTATGTGGG - Intronic
1108743249 13:53361171-53361193 CTTTTTAATTGCCTATTTATAGG + Intergenic
1108786969 13:53915793-53915815 CTGTTTATTTGCTTATGTATAGG - Intergenic
1109138813 13:58687701-58687723 CTGTTTGATTGCATGCAGATAGG + Intergenic
1109393235 13:61720656-61720678 CCCTTAAATTTCATGTATATGGG - Intergenic
1111039085 13:82720817-82720839 CTGTTGAGTGGCATATATATTGG - Intergenic
1111398861 13:87705573-87705595 CTTTTAAAGTGCATGTATAGAGG + Intergenic
1111409497 13:87855585-87855607 CTATATAAGTGTATGTATATGGG + Intergenic
1112128968 13:96500158-96500180 TTGTATAATTCCATTTATATGGG - Intronic
1112451506 13:99515552-99515574 CTGTTGTATAGCATGAATATTGG + Intronic
1112976569 13:105326769-105326791 CTGTTTCATTCCATGTATTCTGG + Intergenic
1113262739 13:108583596-108583618 ATGTATTATTGCATTTATATGGG + Intergenic
1114403121 14:22428345-22428367 CTTTTTACCTGCATGCATATGGG + Intergenic
1117835253 14:59798277-59798299 CTGACTAATTGCATGAATTTGGG + Intronic
1122001547 14:98660515-98660537 CAGTTTAATTCCATGTATTCAGG + Intergenic
1125009943 15:34860825-34860847 CTGTTAAATTGCAGGTACCTAGG + Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1130170016 15:81501614-81501636 CTGTTTTAATTCATGTAAATTGG - Intergenic
1130331841 15:82928358-82928380 ATATTTAATTGCATGGATGTAGG + Intronic
1131796364 15:96021357-96021379 CTGAATAAATGCATGTATACAGG + Intergenic
1135342172 16:21658446-21658468 CTGTGTAATTCCAATTATATGGG - Intergenic
1139090889 16:63645760-63645782 CTATCTAATTGCATGCTTATTGG - Intergenic
1139258636 16:65568975-65568997 TTGTTTAATTGCATTTTTATTGG - Intergenic
1140051456 16:71485046-71485068 CTGTTTAATTGTATGTTCATTGG + Intronic
1140386207 16:74541774-74541796 ATGTTTTATTGTATGTGTATAGG + Intronic
1145889966 17:28407391-28407413 CTGTTTTATTGCCTGTAAAAAGG + Intergenic
1148969522 17:51467599-51467621 CTATTTCATTGTATGAATATAGG + Intergenic
1149807677 17:59634302-59634324 CTGCTGAATTGCATTTATACGGG + Intronic
1151388981 17:73772882-73772904 GAGTATGATTGCATGTATATGGG + Intergenic
1151810960 17:76441585-76441607 CTTTTGAATTGCACTTATATGGG - Intronic
1152330881 17:79672000-79672022 CTATGTATTTGCATGTGTATAGG - Intergenic
1153169319 18:2297189-2297211 CTTGTTCATTGCAAGTATATAGG - Intergenic
1153801784 18:8677396-8677418 CTGTTCAATTGCTTGCATTTGGG - Intergenic
1153802965 18:8687417-8687439 CATTTTAATTGCATGTTTTTCGG + Intergenic
1154128940 18:11719018-11719040 CTGATGAATTGGATGTAAATAGG + Intronic
1156299492 18:35823734-35823756 ATGTATATATGCATGTATATAGG - Intergenic
1156673542 18:39500003-39500025 CCCTTTAACTGGATGTATATTGG + Intergenic
1158547159 18:58406069-58406091 CTGTTTCCTTGTATGTACATTGG - Intergenic
1159005881 18:63010758-63010780 CTTGTTAATTGCTGGTATATAGG + Intergenic
1159522276 18:69541516-69541538 GTATATAATTGCATGTATCTAGG + Intronic
1160315461 18:77841094-77841116 TTGTTTACTTGAATGTATTTAGG - Intergenic
1165216591 19:34278572-34278594 CTGTGTGATTCCATATATATGGG - Intronic
1168225947 19:54995313-54995335 CTGTTTATTTGCAGCTATGTGGG - Intronic
925041793 2:736955-736977 CTGTATATTTGTGTGTATATGGG + Intergenic
925126409 2:1460550-1460572 CTTATTAGCTGCATGTATATAGG + Intronic
925517555 2:4700360-4700382 CTGTTTAAATGCGTGTAAAAAGG - Intergenic
927617932 2:24619140-24619162 TTGTTTAATTGCTTCTATTTAGG + Intronic
928560476 2:32479046-32479068 TTGTTAAAGTGCATGAATATTGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929242711 2:39668018-39668040 GTATTTGATTGCATGTAAATTGG + Intronic
930211603 2:48644633-48644655 CTGTTTGTATGAATGTATATTGG - Intronic
931087814 2:58852915-58852937 TTTTTTAATTTCATGTATTTAGG - Intergenic
932222818 2:70012614-70012636 CTGTTGAACTGCAAGTACATGGG - Intergenic
933545346 2:83704081-83704103 ATGTTTTATTGCCTGTAAATTGG - Intergenic
934693978 2:96385296-96385318 CTGTTCAGTTACATGTATACTGG + Intergenic
936490995 2:112972061-112972083 GTGTTTAATTTTATGTAGATGGG + Intergenic
937965341 2:127503284-127503306 CTGCCTAATTGCATGTCTTTGGG - Intronic
938222687 2:129584802-129584824 CTTTTTCATTGCTAGTATATAGG - Intergenic
939015235 2:136895434-136895456 CTTTTTAATACCATGTAAATGGG + Intronic
939845334 2:147237521-147237543 ATTTTTCATTGCTTGTATATAGG + Intergenic
940334631 2:152512613-152512635 CTGTTTATTTGCATTTAAAAAGG + Intronic
940408420 2:153332459-153332481 CTGTGTAATTGCTTGTTTATGGG + Intergenic
942420522 2:175802294-175802316 GTGTTTAATTGAAGGCATATGGG - Intergenic
946472903 2:219979283-219979305 CTGTGTCATTGTATGTCTATGGG - Intergenic
947995522 2:234524058-234524080 CAGTTTATTCCCATGTATATGGG - Intergenic
948440202 2:237982094-237982116 CTATTTGATTGTATGTAAATTGG + Intronic
1175024193 20:55884167-55884189 CTGTTTCAGTACATGTATAGAGG + Intergenic
1176677685 21:9794982-9795004 GATTTTAATTCCATGTATATTGG + Intergenic
1176902176 21:14455523-14455545 TTGTCTAATTGCATGGATATTGG + Intergenic
1177211680 21:18078980-18079002 TTGTTTATTTGCATATATTTAGG + Intronic
1177268421 21:18813182-18813204 CAGTTTATTTGGATGTTTATAGG + Intergenic
1177502712 21:21978835-21978857 CTATTTTTTTGAATGTATATGGG - Intergenic
1184238127 22:43197322-43197344 ATGTTTCATTACATGCATATGGG + Exonic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955153741 3:56395083-56395105 CTATTTAATTTCATATAAATAGG - Intronic
955829130 3:62982815-62982837 TTGTTTAATTCCAAGTATTTAGG + Intergenic
956363529 3:68474179-68474201 TTGTTTCATTGTCTGTATATGGG - Intronic
956866714 3:73376341-73376363 ATTTATAATTGCATATATATTGG + Intergenic
958690098 3:97454340-97454362 TTATTTGATTACATGTATATTGG - Intronic
958824222 3:99010141-99010163 ATGTTTGATTGCAAATATATTGG + Intergenic
959168821 3:102818690-102818712 CTTTTTTATTGCTTGTATACAGG + Intergenic
959190202 3:103101886-103101908 CTTTTTAATTGTATCTATTTTGG + Intergenic
959921294 3:111871253-111871275 CTGGATAATTGCATTTATGTAGG + Intronic
959937853 3:112048213-112048235 CTGTTATATTTCAGGTATATTGG - Intronic
960922354 3:122760230-122760252 CTGTTTAATCACATGGATTTGGG - Intronic
962558063 3:136576031-136576053 ATATTTATTTGCATGGATATAGG + Intronic
963376627 3:144474741-144474763 GTGTTTAATTGCTTGTCAATAGG - Intergenic
963844635 3:150142742-150142764 CTGTTTAAGGGTATGAATATTGG + Intergenic
964309941 3:155381841-155381863 ATGTTTACTGGCATGTGTATTGG - Intronic
964626516 3:158764984-158765006 CTGGTTAGTAGCATGTAAATTGG + Intronic
965192453 3:165549009-165549031 CTCCTTCATTGCATGTATAGCGG + Intergenic
965264737 3:166528046-166528068 GTGTTTAATTCTATGTCTATGGG + Intergenic
966527655 3:180937940-180937962 TTTTTTATTTGCATGTATAAAGG + Intronic
966903610 3:184505908-184505930 CTGTATGATTCCATTTATATAGG + Intronic
970076384 4:12226059-12226081 ATGTTTATGTGTATGTATATTGG + Intergenic
970190705 4:13513693-13513715 CTGTTTGATATCATGTATAGTGG - Intergenic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
974506771 4:62784844-62784866 CTGTTTAATAGCAATTATCTTGG + Intergenic
976044171 4:80925561-80925583 CTCTATAATTGCAGGTGTATGGG - Intronic
978740204 4:112128675-112128697 CTGTTTAACTGTGTTTATATAGG - Intergenic
979336236 4:119466228-119466250 TTGTTTAATTAAATGTACATTGG + Intergenic
980187953 4:129486018-129486040 ATGTTTAATAGCATGTTTAATGG + Intergenic
980665051 4:135922510-135922532 GTTTTTAAATGCATTTATATGGG - Intergenic
981877164 4:149560561-149560583 CTGTTTGTTTGCATGTGTTTTGG - Intergenic
982654594 4:158131680-158131702 CTGTTTAATTCCATTTCCATTGG + Intronic
983451605 4:167918592-167918614 CTGATTAATTTTATGTTTATAGG + Intergenic
984434825 4:179696086-179696108 TTGTTTAATTGCTTCTATTTGGG - Intergenic
985397847 4:189563786-189563808 GATTTTAATTCCATGTATATTGG - Intergenic
986258055 5:6118121-6118143 AAGTTCAATTACATGTATATAGG - Intergenic
987795449 5:22622454-22622476 TTTTTTTATTGCATGTATCTGGG - Intronic
987986616 5:25155208-25155230 GTGTTTAAATGCTTGGATATAGG + Intergenic
988122579 5:26985898-26985920 CTATTTATTTGCATATATAGTGG - Intronic
988934759 5:36070906-36070928 CTGCTTAAGTGCATGAATATAGG + Intronic
990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG + Intergenic
990506371 5:56449399-56449421 CTGTTAAATTGCCTGCAGATGGG + Intergenic
992533643 5:77675958-77675980 CTTTTTCATTGCTGGTATATAGG - Intergenic
992984316 5:82211942-82211964 ATGTTCAATTGCTTGGATATGGG - Intronic
994441848 5:99817167-99817189 ATATTTATTTGAATGTATATAGG + Intergenic
996616966 5:125453632-125453654 CTGAGTAATTCAATGTATATAGG - Intergenic
997170425 5:131713696-131713718 CTGTTTAATTGCATGTATATTGG - Intronic
997755244 5:136390176-136390198 CTGTGTAGTTGCATTTATATTGG + Intronic
998414196 5:141933776-141933798 CTGGTTAATTACATCTATTTGGG + Intronic
1004342014 6:14816286-14816308 ATGTTTAATTGGATTTATCTTGG - Intergenic
1004826561 6:19427680-19427702 CAGTATAGTTGCATGTATAAAGG - Intergenic
1005493100 6:26364838-26364860 CAGTTTGCTTGCATGTAGATAGG - Intergenic
1006060660 6:31416250-31416272 CTGTTTTATTTCATGTGTCTGGG + Intergenic
1007157536 6:39760028-39760050 CACTTTAATAGCATGTTTATAGG - Intergenic
1007762807 6:44143306-44143328 CTGTTTTATAGCCTGTATAAGGG - Intronic
1008882798 6:56398543-56398565 CTGTCAAATTGCATTTATTTAGG - Intergenic
1009728741 6:67571394-67571416 ATGCATAACTGCATGTATATTGG - Intergenic
1010073992 6:71779817-71779839 CTTTTTAATTGTAGTTATATAGG - Intergenic
1010267244 6:73880648-73880670 CTTTTTCTTTGCATGTATAAAGG + Intergenic
1011576933 6:88812231-88812253 CTTTTTAATTGCAATAATATTGG - Intronic
1011638768 6:89400335-89400357 GGGTTTATTTGCATGTATGTGGG + Intronic
1013893574 6:115056483-115056505 CTGTTTAATTCTTTGTATAAAGG - Intergenic
1014701152 6:124690245-124690267 CTTGTTAATTGCTGGTATATAGG + Intronic
1015218366 6:130776437-130776459 CTGAGTGATTGCATGAATATAGG - Intergenic
1015574225 6:134653811-134653833 CTATTTGCTTACATGTATATTGG + Intergenic
1015940767 6:138449374-138449396 CTGTTAAATATCATGGATATGGG + Intronic
1017271230 6:152508700-152508722 CTGTTTAATTGCATCCACAGTGG - Intronic
1017577487 6:155821353-155821375 CTGTTTAAATGGATTTATAGGGG - Intergenic
1020558241 7:9696245-9696267 CTGGTTTATTGCATATATCTAGG - Intergenic
1020859986 7:13479854-13479876 CTGTTTAAATGCATATATTTTGG - Intergenic
1020992053 7:15210618-15210640 CTGTTCAATTTCCTGTATAACGG + Intronic
1021331580 7:19344698-19344720 CTTTTTCATTGCTGGTATATAGG + Intergenic
1021396972 7:20162112-20162134 CTCATTAATTGCTTTTATATGGG - Intronic
1022326670 7:29338520-29338542 CTGTTTATTTGCCTGTACAATGG + Intronic
1023675545 7:42625911-42625933 CTGTTTGGTTGTATGTATAAAGG + Intergenic
1024727719 7:52218264-52218286 ATGTTTAATGGCATTTATTTGGG + Intergenic
1026070090 7:67111077-67111099 CTGTTTCCTTTCATGTGTATAGG - Intronic
1027434294 7:78148303-78148325 CTGTATCATTCCATTTATATAGG + Intronic
1028538265 7:91913717-91913739 CTGTTTGCTTGTGTGTATATTGG + Intergenic
1028669937 7:93390270-93390292 CAGTTTAATTCCATTTATATAGG + Intergenic
1031107116 7:117557623-117557645 CTTTTTCATTGAATGTATTTGGG + Intronic
1031333538 7:120497223-120497245 CTCTTTAATTGCATTATTATTGG + Intronic
1033173768 7:139107447-139107469 GTGTTTTATTACACGTATATTGG + Intronic
1033972494 7:147059289-147059311 ATGTTTTATTGCATTTAAATTGG + Intronic
1034480122 7:151313464-151313486 GTGTTTGAGTGCATGTGTATGGG + Intergenic
1034777036 7:153837611-153837633 CTGTCTTATTGAATGTATAGAGG + Intergenic
1038444003 8:27590673-27590695 CTGTGTGATTCCATTTATATGGG + Intergenic
1038776177 8:30532883-30532905 CTGTTTAACTGAATGTATCCTGG - Intronic
1039706822 8:40015814-40015836 CTGCTTAACGGCATGTATAATGG + Exonic
1040922595 8:52639601-52639623 CTTTTTATTTGTAAGTATATGGG - Intronic
1041824486 8:62078263-62078285 ATGCTTAATTTCATGTATATAGG - Intergenic
1041867350 8:62591663-62591685 CTGCTTAATGGCATTTAAATAGG - Intronic
1043698618 8:83254110-83254132 TGGTTTTATTGCTTGTATATAGG + Intergenic
1044793153 8:95868547-95868569 CTGTATAGTTACATGCATATTGG + Intergenic
1045581332 8:103483507-103483529 CTGTTTCTTTGCAGGTATCTTGG - Intergenic
1046703945 8:117429631-117429653 CTGTTTATTTGCTTATTTATAGG - Intergenic
1047291623 8:123536380-123536402 CTGTCTATTTGCATGACTATAGG + Intronic
1048638341 8:136324743-136324765 TTGTGTGCTTGCATGTATATTGG - Intergenic
1048923581 8:139251794-139251816 CTGTTTTATTGCATGTAGCAGGG - Intergenic
1049736063 8:144206246-144206268 CTGTTGAGTTCCATGTAGATGGG + Intronic
1052911765 9:33889314-33889336 CTGTTTTGTTGCATCTTTATGGG + Intronic
1053341028 9:37331731-37331753 CTGGTTAATTGGATATATGTTGG + Intronic
1053462956 9:38284764-38284786 CTTTTTAATTGCATCTAATTTGG + Intergenic
1054910808 9:70453572-70453594 GGGCTTAATTGCATGTATTTTGG + Intergenic
1057148517 9:92775540-92775562 CTGTTTAATTTGATGAATGTGGG - Intergenic
1057615957 9:96590217-96590239 CTGCTTGATTCCATGTATATAGG - Intronic
1058708194 9:107655032-107655054 CTGTTTGCTTGCATGGATAGCGG + Intergenic
1059250536 9:112884022-112884044 TTAGTTAAGTGCATGTATATTGG + Intronic
1059369388 9:113814086-113814108 GTCTTTAATTGCATTTATTTAGG - Intergenic
1185802764 X:3028553-3028575 CGATTTAATTCCATGTATGTGGG + Intronic
1188921738 X:35985966-35985988 CAGTTTAATTACATGTAAAATGG - Intronic
1189650562 X:43184511-43184533 CTGTTTCATTGCTTGTAAATGGG - Intergenic
1190835541 X:54097623-54097645 CTTTTTAATTTTATGTATTTTGG + Intronic
1192666163 X:73088032-73088054 CTTTTTCATTTCTTGTATATAGG - Intergenic
1197033640 X:121848929-121848951 CTCTATTATTCCATGTATATTGG + Intergenic
1197170926 X:123433209-123433231 TGTTTTAATTCCATGTATATAGG + Intronic
1197308267 X:124870875-124870897 CATTATAATTGCATGTTTATGGG + Intronic
1198493567 X:137167707-137167729 CTGTCTAATTTTATATATATTGG + Intergenic
1200929789 Y:8686648-8686670 CTGTTTCATTTCATCTACATGGG - Intergenic
1200938838 Y:8761778-8761800 CTGTTTAATTTCATCTGCATGGG - Intergenic