ID: 997174183

View in Genome Browser
Species Human (GRCh38)
Location 5:131756954-131756976
Sequence GGTGTGAAAGGGCCAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997174179_997174183 -8 Left 997174179 5:131756939-131756961 CCACAGAAGATTCCAGGTGTGAA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG 0: 1
1: 0
2: 1
3: 12
4: 146
997174177_997174183 27 Left 997174177 5:131756904-131756926 CCTTAAATCTGTGATAGGACTAA 0: 1
1: 0
2: 0
3: 12
4: 196
Right 997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997174183 Original CRISPR GGTGTGAAAGGGCCAAAAGT AGG Intronic
900524725 1:3122989-3123011 GGTGTGCAAGGGGCCAAGGTGGG + Intronic
903458959 1:23507690-23507712 GGTGTGAAAGGGACAGTAGAGGG + Exonic
904563155 1:31412267-31412289 GGTGTGAGAGACCCAGAAGTAGG - Intronic
904589416 1:31602166-31602188 GGTGAGAAAAAGCCAAAAGACGG - Intergenic
906775713 1:48527830-48527852 GGCGTGAAAGACACAAAAGTCGG + Intergenic
912304628 1:108554752-108554774 GGTAGGAAAGGGGGAAAAGTGGG + Intergenic
912777088 1:112512536-112512558 GATGTGAATTGGCCAAAAGCAGG + Intronic
1063811119 10:9708929-9708951 GGTGTTAAAGTTCTAAAAGTAGG + Intergenic
1065484214 10:26221618-26221640 GTTGGGAAGAGGCCAAAAGTCGG - Intronic
1066407489 10:35132349-35132371 ACTGTGAAATGGCCAAAAGCAGG + Intronic
1067767196 10:49095727-49095749 AGTGTGAAAGGGCCAGACGAGGG - Intronic
1069460277 10:68588524-68588546 AATGTGAAAGGCCCAAAAGATGG + Intronic
1071757480 10:88560145-88560167 GATGAAAAAGGGCCTAAAGTAGG + Intronic
1072216226 10:93289493-93289515 GTGGGGAAATGGCCAAAAGTTGG - Intergenic
1073280844 10:102352846-102352868 TGTGGGAGAGGGCCAAAATTAGG + Intronic
1076721264 10:132394419-132394441 GGGGTGAAAAGGCCAAGAGTGGG - Intergenic
1077008125 11:368833-368855 GGTGAGAAAGGGCACGAAGTGGG + Intergenic
1078148485 11:8738873-8738895 GGTGTGAAAGAGCTAAGAGTTGG - Intronic
1078854899 11:15199228-15199250 GGTGTGAAAGGGCATAACTTAGG - Intronic
1079881398 11:25931954-25931976 GGTGTTAATGGGCCACATGTAGG - Intergenic
1080547085 11:33331279-33331301 GATGTGAAAGGGCCACCAGTAGG + Intronic
1080567468 11:33525251-33525273 AGTGTGAGAGGGGGAAAAGTTGG + Intergenic
1083414674 11:62517819-62517841 GGTCTGAAAGGTTCAGAAGTAGG - Exonic
1083415149 11:62520735-62520757 GATGTCAAAGGCCCTAAAGTGGG - Exonic
1086005387 11:82029906-82029928 GTTGTGAAAGGTCCAAATATGGG - Intergenic
1088757062 11:112893961-112893983 GGAGTGAAAAGGCCAGAAATGGG - Intergenic
1088814361 11:113411128-113411150 GGTGGGAAAGGGACAAATGAGGG - Intronic
1091292017 11:134446012-134446034 GGTGAGACAGGGCCAGCAGTTGG + Intergenic
1091846651 12:3661144-3661166 GGTGAGAAAGGGACAGAAATTGG - Intronic
1096079199 12:48822669-48822691 GGTGTGGAAGGAAGAAAAGTAGG + Intronic
1099067561 12:78002313-78002335 GGTGAGAAATGGCAAAAAGATGG - Intronic
1099124594 12:78737378-78737400 AATGAGAAGGGGCCAAAAGTTGG - Intergenic
1102438861 12:112946369-112946391 GGGGTGAAAGGGCGACAACTTGG + Intronic
1102495342 12:113315476-113315498 GCTGTCAAGGGGGCAAAAGTGGG + Exonic
1103735697 12:123059466-123059488 GGTGCTAAAGGGCCAGAAGGTGG - Intronic
1104169661 12:126267823-126267845 GTAGTGAAATGGCCAAAGGTTGG + Intergenic
1105402615 13:20109365-20109387 GGTGTGAAGGGGTCAAAAGCTGG - Intergenic
1109184805 13:59255206-59255228 GCTGTGACAGGGCACAAAGTTGG - Intergenic
1112370258 13:98787699-98787721 GGTCTGGAAGGGCCAAGAGACGG - Intergenic
1115855014 14:37621865-37621887 CTTGTGAAAGGGCCAATAGGTGG + Intronic
1116342297 14:43739369-43739391 AGTGGGAAAGGATCAAAAGTTGG - Intergenic
1116957904 14:50943458-50943480 GGTGTGGAAGGGCTAAGGGTCGG + Intronic
1117828069 14:59724240-59724262 GGTGAGAAAGCTCCAAAACTAGG + Intronic
1117834972 14:59794620-59794642 GGTGTGACAGGGCAACAAGATGG - Intronic
1119080412 14:71687844-71687866 GAGGTGAAAGGGCCATAGGTGGG + Intronic
1119162657 14:72465912-72465934 TGTCTGAAAGGGACAAAAGGGGG - Intronic
1120511917 14:85425588-85425610 GGAGTAAAAGGGGGAAAAGTTGG + Intergenic
1122225377 14:100273702-100273724 GGTGTGAGAGGGGTAAAACTAGG + Intronic
1122418613 14:101561844-101561866 GGTGTGGCATGGCCAGAAGTTGG + Exonic
1123756861 15:23403682-23403704 GGACTGAAAGGGCAAAAAGTCGG - Intergenic
1125664382 15:41418023-41418045 TGCGTGAAAGGGCCAAGAGGAGG - Intronic
1125901112 15:43348660-43348682 TGTGTGAAAAGGCACAAAGTAGG + Intronic
1126348452 15:47719425-47719447 GGGGTGAAAGGGCAATGAGTAGG + Intronic
1126360661 15:47842580-47842602 GGTATGAAAGGGCCACACTTCGG + Intergenic
1126772268 15:52070278-52070300 GGTGAGAAAGGACCAGAAGCTGG - Intergenic
1130119454 15:81034723-81034745 AGTTTGAAAGTGCTAAAAGTGGG - Intronic
1131410873 15:92207474-92207496 GGTGTGGAAGGGACCCAAGTGGG - Intergenic
1134459466 16:14419047-14419069 GGGCCGAAAGGGCAAAAAGTCGG + Intergenic
1137891594 16:52168687-52168709 GGTGTGAAATTTGCAAAAGTTGG + Intergenic
1138303072 16:55948767-55948789 GGTGAGAAAGGGTCAAATTTAGG + Intronic
1143155591 17:4833987-4834009 GGTGGAAAAGGGCCGAAAGGAGG - Intronic
1143183195 17:4996875-4996897 GGGCTGAAAGGGCCTAAAGTGGG + Exonic
1143372060 17:6446613-6446635 GGTGTGAAAGGCCCAAGAGTTGG + Intronic
1143996517 17:11011242-11011264 GGGGTGAGAGGGGCAAGAGTGGG + Intergenic
1147789411 17:43004070-43004092 GGCGGGAAGGGGCCAAAAGTAGG + Intergenic
1149850858 17:60032850-60032872 GGGGAGAAAGGGACCAAAGTGGG - Intergenic
1149859308 17:60113674-60113696 GGGGAGAAAGGGACCAAAGTGGG + Intergenic
1151052226 17:70991110-70991132 GGTGTGCAAGGGCCCAATCTCGG - Intergenic
1152536983 17:80956556-80956578 GCTTTGATAGGGCCAAAAGGAGG + Intronic
1154995063 18:21632603-21632625 CATGTGAAAGGGCTAAAATTGGG + Intergenic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1163290673 19:16377229-16377251 GAGGTGAAAGGGCCAGAAGGTGG + Exonic
1163795601 19:19336054-19336076 GGTTTGAAAGGGCCACAGCTTGG - Intronic
1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG + Intronic
925589374 2:5494155-5494177 GGTGTGGAATGGGCAAAAGGCGG - Intergenic
925802667 2:7616891-7616913 GAGGTGAAAGGGCAAAAAGGGGG - Intergenic
929606252 2:43236188-43236210 GGTGTGATGTGGCCAGAAGTGGG + Intronic
934573871 2:95388511-95388533 GGTGGGAAAGGGGCAAAGGCAGG + Intergenic
938663404 2:133509867-133509889 AATGTGAAAAGGCCAGAAGTAGG + Intronic
941431333 2:165417765-165417787 AGTGTGAGAGGGAAAAAAGTTGG - Intergenic
944308299 2:198202841-198202863 GGAATGAAAGTGTCAAAAGTGGG + Intronic
945800699 2:214426119-214426141 GGTGTGCAATGGCCAGAACTCGG - Intronic
948148134 2:235723926-235723948 GGTGTGAAAGTGGCAAAAGGAGG + Intronic
1170568300 20:17618933-17618955 GGCAAAAAAGGGCCAAAAGTTGG + Intronic
1171177944 20:23068250-23068272 AGTGGGGAAGGGCCAAGAGTAGG - Intergenic
1173442271 20:43088578-43088600 AGAGTTAAAGGGCCAAAAGTGGG - Intronic
1173849023 20:46206205-46206227 GGAGTGAAATGGCCAAAGGCTGG + Intronic
1174137041 20:48386764-48386786 GGTGTGAAAAGGCAAAATGCAGG + Intergenic
1174547904 20:51339908-51339930 GGTGGGAATGGGGAAAAAGTGGG - Intergenic
1175809879 20:61852257-61852279 GGTGTGCAAGGGCCAGAGCTGGG - Intronic
1180739712 22:18044654-18044676 GGTGTGAAAAGCCCAGAAATAGG + Intergenic
1184002905 22:41688465-41688487 CGTGGGAGAGGGCAAAAAGTTGG - Intronic
1184625233 22:45722194-45722216 GGTGTGAAGGATGCAAAAGTAGG - Intronic
1185295389 22:50050592-50050614 GGAGAGAAAGAGCAAAAAGTTGG + Intronic
949158122 3:851223-851245 AGTGTGAAAGCCCCAAAAGGTGG + Intergenic
950285148 3:11738966-11738988 TGGGTGAAGGGGCCAAAAGGTGG - Intergenic
950416114 3:12869783-12869805 GGTGGGAAGGGGCCACAGGTGGG - Intronic
950572638 3:13811535-13811557 AGGGTGGAAGGGCCAAGAGTGGG + Intergenic
951126057 3:18984931-18984953 GGTTTGAAAGAACCAAAATTGGG + Intergenic
952981656 3:38741043-38741065 GCTGTGAAAGGGGCAGCAGTAGG - Intronic
952989015 3:38814803-38814825 GGTTTGAAATGGCATAAAGTTGG - Intergenic
955572186 3:60319801-60319823 GGCATGAAAAGACCAAAAGTCGG - Intronic
957201891 3:77146665-77146687 GGTGTAAAAAGGCCAAGATTTGG + Intronic
959611494 3:108300133-108300155 GGTTTGAAAGGACCAACAGAAGG + Intronic
961938378 3:130610667-130610689 GGTGTGAAAGGAGAAAAAGGAGG + Exonic
962979632 3:140476167-140476189 GATATGAAAGGGCAAAAAATTGG + Intronic
965625877 3:170683704-170683726 GTTGTGAAAGGTCCAAATATGGG + Intronic
967237217 3:187397167-187397189 TGAGTGAAAGAGCCAAAAGTTGG + Intergenic
971647403 4:29226896-29226918 GGTGCCAGAGGGACAAAAGTGGG - Intergenic
973206705 4:47569169-47569191 GGTGTGAAAGGGAGAAGAGCAGG - Intronic
981633498 4:146848831-146848853 GGTCTGAAAGGGTGGAAAGTTGG + Intronic
990280057 5:54240480-54240502 GTTGTGAAAAGGACATAAGTAGG - Intronic
993855680 5:93071610-93071632 GGTGTGAAAGCCTCAAAATTCGG - Intergenic
996974235 5:129411150-129411172 AGTGTGAAAGGGCAAAATCTTGG - Intergenic
997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG + Intronic
998038680 5:138937312-138937334 GGTGTTAGAGGGCAAAAAGCTGG + Intergenic
998089026 5:139351346-139351368 TGTGTGTAATGGCAAAAAGTGGG + Intronic
998113193 5:139517782-139517804 GGTGTCGAAGGGCCAAAATGTGG + Intergenic
998855886 5:146394846-146394868 GGTGTAAAAGAGCCAGGAGTTGG + Intergenic
1002526315 5:179817698-179817720 TGTCTGAAAGGGCTAAAAGGGGG + Intronic
1006895052 6:37462835-37462857 GGTGTGCAAGGGCCTGAAGGTGG + Exonic
1008745471 6:54664853-54664875 GGTGTGAGAGGGCGAAAAAAGGG - Intergenic
1008763190 6:54879043-54879065 GGTGTCAGAGGCCCCAAAGTTGG + Intronic
1010540796 6:77089635-77089657 GGTGTGAAAGGGCCAGATTCTGG - Intergenic
1010800176 6:80166131-80166153 GGCATTGAAGGGCCAAAAGTAGG - Intronic
1010927233 6:81757219-81757241 GGTGTGGAAAGACCAAAAGCAGG - Intergenic
1013807618 6:114012604-114012626 GGTGTTAAAGGGCTAAGAATTGG + Intergenic
1014110089 6:117610637-117610659 TGTGTGAAAACTCCAAAAGTCGG + Intergenic
1017244425 6:152207218-152207240 GATGGGAAAGGGAGAAAAGTTGG + Intronic
1019119904 6:169794246-169794268 GGTGTGGAAGGGCGAATACTCGG - Intergenic
1022274532 7:28842357-28842379 GTTGTGGGAGGGCCACAAGTGGG - Intergenic
1023399318 7:39780360-39780382 GGTGGGAAGGCGCTAAAAGTGGG + Intergenic
1023705769 7:42940501-42940523 GATGTGAAAGGGAGAAAAGGTGG - Intronic
1024651132 7:51404350-51404372 GGTGGGAAGGTGCTAAAAGTGGG - Intergenic
1025055259 7:55759929-55759951 GGTGGGAAGGTGCTAAAAGTGGG - Intergenic
1025133333 7:56390158-56390180 GGTGGGAAGGCGCTAAAAGTGGG - Intergenic
1026137946 7:67679903-67679925 GCTGAGAATGGGCCAAGAGTTGG + Intergenic
1027733474 7:81904250-81904272 AGTGTGACAGGGAGAAAAGTTGG - Intergenic
1028706097 7:93848731-93848753 GGTGTGAAAAGGGGAAATGTTGG - Intronic
1028909142 7:96188364-96188386 GGTGGGAAAGAGCTAAAAGAAGG + Intronic
1038714777 8:29981820-29981842 GGTGGGGAAGAGCCAAAAATCGG - Intergenic
1041314403 8:56546306-56546328 AGTGTCAAAGGGCCATCAGTTGG - Intergenic
1043061853 8:75515605-75515627 GGAGTCAAAGGGCCAAAACCTGG + Intronic
1043618620 8:82159690-82159712 AGTTTGAAAGGGGAAAAAGTAGG - Intergenic
1047695011 8:127394886-127394908 GGTGGGGAAGGGCTAATAGTGGG - Intergenic
1053563854 9:39226452-39226474 GGTGAGAGAGAGACAAAAGTAGG + Intronic
1053829641 9:42064349-42064371 GGTGAGAGAGAGACAAAAGTAGG + Intronic
1054133294 9:61392618-61392640 GGTGAGAGAGAGACAAAAGTAGG - Intergenic
1054451044 9:65403836-65403858 GGTGTGTGGGGGCCAAAGGTGGG - Intergenic
1054600920 9:67123105-67123127 GGTGAGAGAGAGACAAAAGTAGG - Intergenic
1059146586 9:111905097-111905119 TGAGTGAAAGGGCCAAAGGGTGG - Intronic
1061419615 9:130466250-130466272 GGTGTGGAAGGGAAAGAAGTGGG - Intronic
1185912869 X:4001614-4001636 GGTGTAGAAGGACAAAAAGTAGG - Intergenic
1186948508 X:14596245-14596267 AGTGTGCAAAGGCCAAAAGTAGG - Intronic
1187021276 X:15385025-15385047 GGTTTGAAAGGGCCAAAACCTGG - Exonic
1187024935 X:15425311-15425333 GGTGTGGAAGGCCTAAAAGATGG - Intronic
1187466113 X:19529203-19529225 GGTGTCAAATGGGCAGAAGTAGG - Intergenic
1192322071 X:70098058-70098080 TCTGTGAAAGCCCCAAAAGTAGG + Intergenic
1194563189 X:95448016-95448038 GGTTTGAAAGGCTCAAAAGAAGG - Intergenic