ID: 997175655

View in Genome Browser
Species Human (GRCh38)
Location 5:131773943-131773965
Sequence GGCATTAAAAAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997175651_997175655 -9 Left 997175651 5:131773929-131773951 CCAGTACAGTGGCTGGCATTAAA 0: 1
1: 0
2: 0
3: 19
4: 299
Right 997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG 0: 1
1: 0
2: 1
3: 33
4: 296
997175650_997175655 -8 Left 997175650 5:131773928-131773950 CCCAGTACAGTGGCTGGCATTAA 0: 1
1: 0
2: 11
3: 100
4: 828
Right 997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG 0: 1
1: 0
2: 1
3: 33
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997175655 Original CRISPR GGCATTAAAAAGAGGGAGCA GGG Intronic
901330965 1:8408202-8408224 GCCATTAAAAAAAGGGAGGGTGG + Intronic
904454032 1:30636271-30636293 GACATTGAAAAGAGGGAGTGTGG + Intergenic
904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG + Intergenic
904976459 1:34460626-34460648 GCCATTAAAAAGAAGGAGCCTGG - Intergenic
905334219 1:37232959-37232981 AGCATTAAAAAGAGGATGGAAGG + Intergenic
905907377 1:41627918-41627940 GGGATTAGAAAGAGGGTGCCTGG - Intronic
906540606 1:46583044-46583066 GGCATTACAGAAAGAGAGCAGGG - Intronic
906561798 1:46763697-46763719 GGCTTTACACAGAGGGAGCCTGG - Intronic
908142663 1:61203447-61203469 GGCATAGAAAAGGGGGAGGAGGG - Intronic
910253718 1:85225188-85225210 GGCCTTGAAAAGAGAAAGCAGGG + Intergenic
911035246 1:93536686-93536708 GGTATTATAAAGAGGGTGCTGGG + Intronic
911363266 1:96905930-96905952 GCCATTACAAAGAGGGATTATGG + Intergenic
912598387 1:110902578-110902600 GGCATTAAAAACAGTGATCTCGG + Intergenic
913260760 1:116996059-116996081 GGCCTTAAAGAGAGGCAGAAAGG - Intergenic
913961934 1:143346311-143346333 GTCATTTAAAATAGGGAGCAAGG + Intergenic
914056289 1:144171885-144171907 GTCATTTAAAATAGGGAGCAAGG + Intergenic
914122857 1:144794477-144794499 GTCATTTAAAATAGGGAGCAAGG - Intergenic
915798959 1:158768103-158768125 GACATTAAAAGGATGGGGCATGG - Intergenic
916449079 1:164902634-164902656 GGCCTGACAAAGAGGGATCAAGG - Intergenic
918808464 1:189081754-189081776 GGCATAAAAAAGATTGAGAAAGG + Intergenic
920749804 1:208663123-208663145 GGAATAAAAAAGGGGGAGGATGG - Intergenic
922137875 1:222850331-222850353 GGGTTTAAAAAGAGAGAACAAGG - Intergenic
922192202 1:223329166-223329188 GGCATAAACAAGAGGGAGAATGG + Intronic
1063648918 10:7913965-7913987 GGCATGAAAAAAAGAGAGCAGGG + Intronic
1064734587 10:18368460-18368482 GGCAATAAAAATAGAGAGCAAGG - Intronic
1067085171 10:43234382-43234404 GCCTTTTAGAAGAGGGAGCAGGG - Intronic
1067168303 10:43882992-43883014 GTCCTGAAAAAGAGGGAGAATGG + Intergenic
1068299384 10:55118993-55119015 CCCATTGAACAGAGGGAGCATGG - Intronic
1069128772 10:64672343-64672365 AGGATTAAAAAGAGAGAGCTGGG - Intergenic
1069273570 10:66561654-66561676 GACATTCAAAACAGGAAGCAAGG + Intronic
1071665265 10:87549145-87549167 GGCAGTAAAAAAAGGGGGGAAGG + Intronic
1072303028 10:94080161-94080183 GGCATTTAAATGAGGGACTAAGG - Intronic
1075131653 10:119745141-119745163 GGAAAGAACAAGAGGGAGCATGG - Intronic
1076104853 10:127813519-127813541 GGAAGGAAAAAGAGGGAGGAAGG + Intergenic
1076483760 10:130802485-130802507 CCCAGTAATAAGAGGGAGCACGG - Intergenic
1077564481 11:3288377-3288399 GACGTTAAAAAGAGAGAGGAAGG + Intergenic
1077570371 11:3334194-3334216 GACGTTAAAAAGAGAGAGGAAGG + Intergenic
1078346029 11:10549336-10549358 GACATGAAGAAGTGGGAGCAAGG + Intergenic
1080047326 11:27822437-27822459 GGGAATAAAAAGAGGAAGGAAGG - Intergenic
1080764798 11:35285676-35285698 GGCATAAGTAATAGGGAGCAGGG + Intronic
1082083484 11:48030155-48030177 GGGATTAAGAAGTGGGGGCAGGG + Intronic
1082219844 11:49621379-49621401 GCCATTTAAAAGAGAGAGCAGGG - Intergenic
1083682596 11:64358336-64358358 GGCAGGAAGAAGACGGAGCAGGG + Intergenic
1084279515 11:68078319-68078341 GGCAGCAAAAAGAGGGGCCAGGG + Intronic
1084836360 11:71804472-71804494 GGCCTTAAGCAGGGGGAGCAGGG - Intergenic
1086629786 11:89003398-89003420 GCCATTTAAAAGAGAGAGCAGGG + Intronic
1088261028 11:107944211-107944233 GGAAGGAAAAAGAGGAAGCATGG + Intronic
1089177110 11:116557038-116557060 GGCATGAAGAAGAGGGACCTTGG - Intergenic
1091002063 11:131918036-131918058 TGCATTTAAAAGAGGGAGAAAGG - Intronic
1091111462 11:132972813-132972835 GGCCTCAAGCAGAGGGAGCAGGG - Intronic
1092223772 12:6733076-6733098 GGAATTAGAAAGTGGGAGTAGGG + Intergenic
1093554924 12:20460816-20460838 GCCATGAAAAGGGGGGAGCAGGG - Intronic
1094487944 12:30939705-30939727 GGCAAGAAAAAGAGGGCGAAGGG + Intronic
1094526356 12:31233845-31233867 CTCATGAAAAAGAGGGAGAAAGG - Intergenic
1098634412 12:72764033-72764055 GGAATTAAAAATAGACAGCATGG + Intergenic
1099225196 12:79960849-79960871 GGCACTAAAAAAAGGAAACAAGG - Intergenic
1099887691 12:88552001-88552023 GGCATTGAAAATAGAGAGAAGGG + Intronic
1100220331 12:92497918-92497940 GGAGTTAAAAAGAGAGAGAAAGG + Intergenic
1102675470 12:114655339-114655361 GGCTTTGAAAAGAGTGAGAAAGG - Intergenic
1104925356 12:132311228-132311250 GACATTTCAAAGAGGGAGAAAGG + Intronic
1105272381 13:18889987-18890009 GGCCTTAAGAAGAGGGAGGCAGG - Intergenic
1105939729 13:25136982-25137004 GGCATTTAAAAGAGAGTGAAGGG - Intergenic
1107677648 13:42813372-42813394 GTCATTAAAAAGTGCAAGCACGG + Intergenic
1109908098 13:68872396-68872418 GTCATTCAAAAGAAGGAGAATGG - Intergenic
1110008497 13:70302267-70302289 GGCAGGAGAAAGAGAGAGCAGGG + Intergenic
1110476082 13:75915734-75915756 AGCATTAAAAATGGGGAACATGG - Intergenic
1110634583 13:77751728-77751750 GCCTTTCAGAAGAGGGAGCAGGG + Intronic
1111306099 13:86414778-86414800 GGCAGAAAAGAGAGAGAGCAAGG - Intergenic
1111537420 13:89621211-89621233 GGGAATAAAAGGAGGGAGGAAGG - Intergenic
1111828269 13:93295985-93296007 GCCATTACAAAAAGGGAGCTTGG - Intronic
1111851673 13:93583709-93583731 AGTATTAAAAAGAGGGGGCCAGG - Intronic
1112179754 13:97067105-97067127 GGCATAAAAAAAAGAGTGCAAGG - Intergenic
1112325016 13:98438330-98438352 GGCTATAAAAAGTGGCAGCAAGG - Intronic
1113150077 13:107253462-107253484 GGCACTCACTAGAGGGAGCAAGG - Intronic
1114411626 14:22506214-22506236 GGAATTCAAAGGAGAGAGCAGGG - Intergenic
1114799419 14:25756287-25756309 GGTAATAAAAAGAGGCATCAAGG - Intergenic
1116569797 14:46501556-46501578 AGCATTAAAAACAGAGAACAGGG - Intergenic
1116738489 14:48725530-48725552 GGCATTAATGAGAGCCAGCAAGG + Intergenic
1116961023 14:50968571-50968593 GGAATTAAGAAGTGGAAGCATGG - Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1118285993 14:64473477-64473499 GGCATTAAAGATATGGATCATGG + Exonic
1119436751 14:74602486-74602508 GGTATTAAGAAGAGGGACCCTGG + Intronic
1119996254 14:79257064-79257086 TGCTTTAAAAAGAGGGCCCAAGG - Intronic
1120534948 14:85683314-85683336 GTAAATAAAAAGAGGGAGCCAGG + Intergenic
1120598881 14:86475441-86475463 GGCATTTAAAAGAGGAAGTGAGG + Intergenic
1121124047 14:91394521-91394543 GTCATTACAATCAGGGAGCACGG - Intronic
1122159890 14:99775329-99775351 GGCATTCAGAGGAGGGAGAAAGG + Intronic
1122600160 14:102917396-102917418 GGCATTAAAATGAGACAGGAAGG - Intergenic
1123693664 15:22860920-22860942 GGGATTGATAGGAGGGAGCAGGG - Intronic
1124585724 15:31004659-31004681 GGCTTTAAAAAAAGGAAGCCAGG - Intronic
1125282260 15:38055217-38055239 GGCATTAAAAATAGTGATTAAGG - Intergenic
1125679640 15:41522798-41522820 GGTATTAAGAAGAGAGAGGAGGG + Exonic
1127960535 15:63887187-63887209 CCTGTTAAAAAGAGGGAGCAGGG - Intergenic
1129816656 15:78561261-78561283 GGAGTTAAAAAGAGAGTGCATGG - Intergenic
1130687154 15:86048711-86048733 AGCATTGCAAAGAGGAAGCATGG - Intergenic
1133566054 16:6994439-6994461 GGCATTAAAAAGAGAGAGCTGGG - Intronic
1135775011 16:25250012-25250034 GTCATAAAAAAGAAGGAGCCTGG + Intronic
1138748729 16:59393895-59393917 GGCATTGAAGAGGGGGAGCAAGG - Intergenic
1139377697 16:66510602-66510624 GGCTGTAAATAGAGGTAGCAAGG - Exonic
1140153536 16:72398428-72398450 GGCATTGAAGAGAGGGAGTGGGG + Intergenic
1140804012 16:78516017-78516039 AACCTTAAAGAGAGGGAGCAGGG - Intronic
1143288490 17:5810380-5810402 GGGATGAGAAAGAGGGAGGACGG - Intronic
1145395474 17:22490693-22490715 GGCCTTAGAAAGAGGCAACAGGG + Intergenic
1147527065 17:41235797-41235819 GGGAGGGAAAAGAGGGAGCAGGG + Intronic
1148031139 17:44621925-44621947 GTCAGGAAAAAGAGGGGGCAAGG - Intergenic
1150113845 17:62527026-62527048 GGCATGAAGGAGAGGGAGAATGG - Intronic
1150139133 17:62713821-62713843 GGCATTAATAGGAGGGGGCGGGG + Intronic
1151812340 17:76452162-76452184 GCAATTAAAAGGAGGCAGCAGGG + Intronic
1152202680 17:78956289-78956311 GGAATTACTAAGAGGAAGCAGGG + Intergenic
1154038473 18:10831017-10831039 GGCAATAAAAAGTGCTAGCAAGG + Intronic
1154464161 18:14627571-14627593 GGCCTTAAGAAGAGGGAGGCAGG - Intergenic
1154981091 18:21502959-21502981 TGCACTAAAATGAGGGAGAAGGG - Intronic
1155894240 18:31303697-31303719 GGCCTTAAAGTGGGGGAGCATGG - Intergenic
1156929515 18:42624974-42624996 TGCATAAAAACGAGGGAGAATGG + Intergenic
1157150386 18:45211272-45211294 GGGATTTAAAAGGGGGAGAAAGG - Intergenic
1158005861 18:52671373-52671395 AACATTAAAAAGAGCCAGCAAGG - Intronic
1158975598 18:62708687-62708709 GGAATGAAGAAGTGGGAGCATGG - Intergenic
1159566043 18:70051282-70051304 GGCATATAAAAGAGGTATCAGGG - Intronic
1159958822 18:74539733-74539755 TCCATTAAAACGAGAGAGCAGGG - Intronic
1160829778 19:1098344-1098366 GGCGAGAAAAAGAGGGAGAAAGG + Intergenic
1161365526 19:3877190-3877212 TGAATAAAAAAGAGGGAGGAAGG - Intergenic
1162262853 19:9546653-9546675 GGGATTAGAAAGAGTGAGGAGGG - Intergenic
1162350623 19:10146956-10146978 GGCCTTAAAAATAGAGATCAAGG + Intronic
1162451047 19:10755352-10755374 GTCATTGAAAGGATGGAGCAGGG + Intronic
1166023998 19:40062972-40062994 GCAATTAAAAAGAGTGGGCATGG - Intergenic
1166349890 19:42191674-42191696 GGCAGAAAACAGAGGGATCAAGG + Intronic
1167511580 19:49897844-49897866 GGCATTAACAAGAAGGAAGATGG + Intronic
1168368549 19:55811402-55811424 GGCAGGCAAAAGAGGGAGCCTGG + Intronic
1168407812 19:56120168-56120190 GGCACTAGAGACAGGGAGCAGGG - Intronic
1202695772 1_KI270712v1_random:124568-124590 GTCATTTAAAATAGGGAGCAAGG + Intergenic
926680540 2:15660527-15660549 GGAAATAAGAAGAGGGAGCATGG + Intergenic
926991526 2:18685711-18685733 TGCAAAAAAAAGAGGGGGCATGG - Intergenic
928666488 2:33555180-33555202 GTCATTAAAAAGAGAGAGCCAGG + Intronic
930296152 2:49556860-49556882 GGCAAAAAAAATAGGGGGCATGG + Intergenic
932166268 2:69510373-69510395 GCCATAAAAAAGAAGGAGGATGG - Intronic
933092587 2:78138771-78138793 GGCAAGAAAAAGAGAGAGAAGGG - Intergenic
933212148 2:79582722-79582744 GGCATTGAAAAGAGGGAAGAAGG - Intronic
933491833 2:82994453-82994475 GGCCTTAAAAATTGGAAGCATGG - Intergenic
933769003 2:85730984-85731006 GGCACTAAAAAGAAGGTGAAAGG - Intergenic
934151433 2:89151232-89151254 GGCATGAGACAGAGGCAGCAGGG + Intergenic
934215825 2:90030674-90030696 GGCATGAGACAGAGGCAGCAGGG - Intergenic
934276934 2:91581610-91581632 GTCATTTAAAATAGGGAGCAAGG + Intergenic
936275827 2:111096177-111096199 GGAATTAAAAACTGGGAGGATGG - Intronic
936450481 2:112630351-112630373 GGCTTTAGAAAGAGACAGCAGGG - Intergenic
937813323 2:126222632-126222654 GGCAAGGAAAAGAGGGAGGAGGG + Intergenic
938273763 2:129998074-129998096 GGCAGGAGAAAGAGGAAGCATGG + Intergenic
938442446 2:131348041-131348063 GGCAGGAGAAAGAGGAAGCATGG - Intronic
938899022 2:135782724-135782746 GATACGAAAAAGAGGGAGCAAGG - Intronic
939175049 2:138738755-138738777 GGCATTAACCAGGCGGAGCAAGG - Intronic
939650249 2:144752242-144752264 GGGACTACAAAGAGGAAGCATGG + Intergenic
941827556 2:169916977-169916999 GGAGGTAAAGAGAGGGAGCAGGG - Intronic
942080150 2:172392802-172392824 GCCTTTAAAAATAGGGAGAATGG + Intergenic
942996063 2:182261991-182262013 CACATAAAAATGAGGGAGCAAGG + Intronic
943951480 2:194135524-194135546 GGCATGAAAATAAGGGATCAGGG + Intergenic
945048568 2:205802446-205802468 GGCATTAAAAATAGTCAGCTGGG - Intergenic
945926366 2:215809550-215809572 GGAATTATATAGAAGGAGCAGGG + Intergenic
946638561 2:221757630-221757652 GTCATTCAAAAGAGGGAAGACGG + Intergenic
948273331 2:236690374-236690396 GGAATTAAGAAGAAGGAGAATGG + Intergenic
1169173912 20:3491441-3491463 GGCAAAAAAGAGAGAGAGCATGG - Intronic
1170292477 20:14785885-14785907 GGAAGAAAAAAGGGGGAGCAAGG + Intronic
1170315438 20:15035871-15035893 GGAAAAAAAAAGGGGGAGCAGGG - Intronic
1170522168 20:17197903-17197925 TGCTCTAAAAAGAAGGAGCAGGG + Intergenic
1170653081 20:18260651-18260673 ATCATTAAAAGGAAGGAGCATGG + Intergenic
1170827239 20:19807314-19807336 GGCATAAGATAGAGGAAGCATGG - Intergenic
1176810374 21:13530817-13530839 GGCCTTAAGAAGAGGGAGGCAGG + Intergenic
1176891261 21:14322140-14322162 GACATGAAACAGAGGTAGCATGG - Intergenic
1178063389 21:28876263-28876285 GTCATTAAAAAAAGGTAGAAAGG - Exonic
1181743052 22:24936660-24936682 GGCATGGAAAAAAGGGAGCAAGG - Intronic
1181788320 22:25243586-25243608 GGCTTTAAAAATAGGAAGCCTGG + Intergenic
1181903552 22:26174699-26174721 GGCTGTGACAAGAGGGAGCAGGG + Intronic
1182176494 22:28294946-28294968 GGCATTAAGAAGTGAGAGCCAGG - Intronic
1182915073 22:34021936-34021958 GCTTTTAAAAAGAGAGAGCAAGG - Intergenic
1182961530 22:34480006-34480028 AGCATTAAAAAAAGAGACCATGG + Intergenic
1184959345 22:47917828-47917850 GGCAGTAAAGAGAGGGAGGAGGG - Intergenic
1185318098 22:50187380-50187402 GGCATCAGAAACAGGAAGCAGGG + Intronic
949203149 3:1405256-1405278 GGCATTAATAATAAGCAGCATGG + Intergenic
951604373 3:24416463-24416485 GGGATTAAAAAGGAGGAACAAGG + Intronic
954678256 3:52327322-52327344 GGGAGGAGAAAGAGGGAGCATGG + Intronic
955840285 3:63105507-63105529 GTCATTAAAAAGAGGGTGGGTGG - Intergenic
956214707 3:66836727-66836749 GTCCTTCAAAAGAAGGAGCATGG - Intergenic
956388536 3:68747156-68747178 GACATAAAATAGAGGTAGCATGG - Intronic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957052007 3:75418317-75418339 GGCCTTAAGCAGGGGGAGCAGGG + Intergenic
958472453 3:94537917-94537939 CCCATTTAAAAGAGGGATCATGG + Intergenic
960407190 3:117276239-117276261 GGTATTCAAAAGAGGGGGAAGGG + Intergenic
961432713 3:126894423-126894445 GACATTAAACATAGGGAGAAAGG + Intronic
961444939 3:126975956-126975978 GGCCTTAAAAAGAGGGTGCCAGG + Intergenic
962775740 3:138657947-138657969 GGCTATAAACAGAGGGAGAAGGG - Intronic
964411140 3:156399015-156399037 GGTATTAAAGAGAGAGAGCTTGG - Intronic
964756905 3:160096934-160096956 GGCAGTAAAAAGAGGTGGTAAGG - Intergenic
965041661 3:163516868-163516890 GGCATTATCAAGAAGGAGGAAGG + Intergenic
966367288 3:179203238-179203260 GGAATTAAAAACAAGGATCACGG - Intronic
966484944 3:180458113-180458135 GGTATTCCAAAGAGGGAACATGG + Intergenic
966902690 3:184498542-184498564 GGGATCAAGAAGAGGGAGAAAGG - Intronic
967086023 3:186096040-186096062 GGCATAAAAATGGGGAAGCAGGG + Intronic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
969033827 4:4234777-4234799 GTCATTTAAAATAGGGAGCAAGG - Intergenic
969759193 4:9170102-9170124 GGCCTTAAGCAGGGGGAGCAGGG - Intergenic
971568107 4:28171277-28171299 GAGATTAAAAAGTAGGAGCAAGG + Intergenic
971618569 4:28825603-28825625 GGCATAAAGGAGAGGGGGCATGG - Intergenic
971656206 4:29348511-29348533 AGCATTTAAAAGATGAAGCAAGG - Intergenic
972319728 4:37962424-37962446 TCCATTAAACAGAGGAAGCAGGG - Intronic
973068187 4:45823247-45823269 GGTACTCAAAAGAGGGAGGATGG + Intergenic
975757489 4:77585186-77585208 GGCTTTAAAAATTGGGAGAAAGG + Intronic
978509831 4:109504403-109504425 GGCATTAAAAAAAGGGAGTGGGG - Intronic
979601555 4:122591332-122591354 GGCATTGACAAAAGGGAGCCAGG - Intergenic
981965339 4:150593464-150593486 GGATTTAAAAACAGGCAGCACGG + Intronic
982179547 4:152737206-152737228 ATTGTTAAAAAGAGGGAGCAAGG + Intronic
984211465 4:176854402-176854424 GGAATTAAGAAGCGGGGGCAAGG + Intergenic
984496146 4:180499393-180499415 GGCATTAAAGACAGGGAAGATGG - Intergenic
984596616 4:181676276-181676298 GAGATTAAAAATAGGGAGTAGGG + Intergenic
984756357 4:183328906-183328928 GGCATTTAAGAGAGGAAGTAGGG + Intergenic
985983276 5:3489577-3489599 GCCATGAAAGAGAGGGAGCTGGG + Intergenic
986442031 5:7791441-7791463 GGCATTAAGAAGAAGGTGCCAGG + Intronic
987385466 5:17325008-17325030 GGCCTTTACAAGAGGGAGCCAGG + Intergenic
987850002 5:23339534-23339556 CCCATTAAAAAGAGGGGGCCAGG - Intergenic
988166457 5:27596251-27596273 GGCAGGAAAGAGAGAGAGCAGGG + Intergenic
990026565 5:51198657-51198679 GGGACTAAAAAGAGGAAGAAAGG - Intergenic
990819611 5:59823229-59823251 GGCATTAAACAGGGGGCGAAAGG - Intronic
992181833 5:74205107-74205129 GGCATGAAAAAGAGGCTGAATGG - Intergenic
994301641 5:98155083-98155105 GGAATTGAGAAGTGGGAGCATGG - Intergenic
994309518 5:98251793-98251815 GACACTAAAAGGAGGGAGAAAGG + Intergenic
995787956 5:115850890-115850912 GGCATTAAATAAAGGGGACATGG + Intronic
996119361 5:119653401-119653423 GGCAGGAGAGAGAGGGAGCAGGG - Intergenic
997142378 5:131396453-131396475 GGCATTAAAAAGATGAGGTAGGG - Intronic
997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG + Intronic
997733680 5:136198401-136198423 GGCACGAAGAAGAGGCAGCAGGG + Intergenic
997741906 5:136262734-136262756 GGCATTGGAAATAGGCAGCACGG + Intronic
1000438373 5:161240923-161240945 GGCATGAAAATAAGGGATCAGGG - Intergenic
1000986079 5:167861885-167861907 TGGATTAAAAAGAGAGAGCAAGG + Intronic
1001314839 5:170634517-170634539 GGCATTCAAAAGAGAGATCCTGG + Intronic
1001680691 5:173554917-173554939 AGGACTAAAAAGAGGGAGAAGGG + Intergenic
1003343721 6:5246039-5246061 AAAATTAAAAAAAGGGAGCAGGG + Intronic
1003809238 6:9761216-9761238 GGCATGAAATAAAGGGATCATGG + Intronic
1003863022 6:10339093-10339115 GTCATCAAAGAGAGGGAGGAAGG - Intergenic
1004835797 6:19530092-19530114 GCCATTATAAACAAGGAGCAGGG - Intergenic
1005123741 6:22421148-22421170 GGCATTAAACAGAAGGATCGTGG - Intergenic
1006745148 6:36336514-36336536 ATCTCTAAAAAGAGGGAGCAAGG - Intronic
1006910156 6:37558429-37558451 CTCACTAAGAAGAGGGAGCATGG + Intergenic
1007120659 6:39377908-39377930 GGCAGTGAGAAGAGGGAGGAGGG + Intronic
1007358119 6:41335482-41335504 GGCAGCACACAGAGGGAGCAAGG + Intergenic
1007389444 6:41542092-41542114 GGCATTAAAACTCAGGAGCATGG - Intergenic
1009268091 6:61581041-61581063 GGTCTTAAAAAGAGGGAGAAGGG + Intergenic
1011026664 6:82877071-82877093 GTCTTTAAAAAGAGGAAGCCTGG + Intergenic
1012084395 6:94805783-94805805 GGCAATAAAAAGTGGGACCCGGG + Intergenic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1013238663 6:108222949-108222971 TGAATTAGAAAGAGAGAGCAAGG - Exonic
1013656542 6:112252824-112252846 TCCATGAAAAAGAGGGAGCATGG - Intronic
1015467742 6:133566599-133566621 GGAATTAAAAAGAGGCACCCTGG - Intergenic
1016145845 6:140672082-140672104 GGCAGTAGAGAGAGAGAGCAAGG - Intergenic
1016640087 6:146338302-146338324 GGCATGGAAAAGACAGAGCAGGG + Intronic
1016669117 6:146680892-146680914 GGCATAAAAAGGGAGGAGCATGG - Intronic
1017689979 6:156954845-156954867 GGAATTAAGAATAGGGTGCAGGG - Intronic
1017891180 6:158640584-158640606 TGCAGTAAAAAGAGGGGACAAGG - Intronic
1018251222 6:161872622-161872644 GGCTTTAATATGAGGGACCATGG - Intronic
1018493452 6:164321937-164321959 GGCACTAAAAAAAGGAAGCAAGG + Intergenic
1019111530 6:169720638-169720660 GGCGCTAAATAGAGGGAGAAAGG + Intronic
1019759397 7:2798879-2798901 GCAATTAAAAAGAGGAAGCCTGG + Intronic
1022103097 7:27180752-27180774 GGCTTCAACAAGAGGGAGCCTGG - Intergenic
1022318519 7:29266277-29266299 GGAATGAAGAAGAGGGAGGAGGG - Intronic
1023058026 7:36305250-36305272 GGCATGAAAGAGTGGGAGCACGG - Intergenic
1023548356 7:41342801-41342823 GAAATTGAGAAGAGGGAGCATGG + Intergenic
1024106935 7:46099399-46099421 TGGATTAAAAAGAGGGAGAATGG + Intergenic
1024131749 7:46360544-46360566 GGCCTCAGAAACAGGGAGCATGG + Intergenic
1028110385 7:86933756-86933778 GGAATTGAGAAGTGGGAGCATGG - Intronic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1030029076 7:105352344-105352366 GGCTTCATCAAGAGGGAGCAAGG - Intronic
1030151033 7:106405103-106405125 GACAGTGAAGAGAGGGAGCAAGG + Intergenic
1031208722 7:118794639-118794661 GTCATGAACAAGAAGGAGCATGG + Intergenic
1032043551 7:128582784-128582806 GGCATGAAGAAGAGGGAGAATGG - Intergenic
1032498724 7:132383132-132383154 GGCTTCAGAGAGAGGGAGCATGG - Intronic
1033331416 7:140420118-140420140 GGGATAAAGAAGAAGGAGCAGGG + Intronic
1034159760 7:148984129-148984151 GGCATGAAGAAGAGGGATCCAGG + Intergenic
1034424171 7:151005656-151005678 AGCATTTAAAAGTGGGAGCAAGG + Intronic
1034864859 7:154632524-154632546 GGGATTATCAAAAGGGAGCAAGG + Intronic
1035522887 8:289460-289482 GGTATTAAAAAGAGAATGCAAGG + Intergenic
1035526955 8:321459-321481 GAAATTAAACAGAGGGAACAAGG - Intergenic
1036847323 8:12178859-12178881 GGCCTTAAGCAGGGGGAGCAGGG + Intergenic
1036868687 8:12421180-12421202 GGCCTTAAGCAGGGGGAGCAGGG + Intergenic
1038468483 8:27789373-27789395 GGCAATAAAAATAGGGAAAAAGG - Intronic
1039837369 8:41267511-41267533 ATCATTAAAAAGAGGGGGCTTGG - Intronic
1040369904 8:46759292-46759314 GGGATTGAAAGGAGGGAGGAAGG - Intergenic
1043414802 8:80035981-80036003 AGTATTAAAAAGAGTGAGGATGG - Intronic
1046745384 8:117870471-117870493 GGCATTAAGTAGAAGGAGCAAGG + Intronic
1047094757 8:121612451-121612473 TGCATAAAAAAGAGGCAGAAAGG + Exonic
1048130860 8:131695331-131695353 GGCAAAAGAAAGAGAGAGCAGGG + Intergenic
1048629691 8:136228633-136228655 GGCATAAAAGAGAGTGAGTAGGG + Intergenic
1049050673 8:140192495-140192517 AGCAGTAAAAACAGGCAGCATGG + Intronic
1049206635 8:141366653-141366675 GGCACTCTGAAGAGGGAGCATGG + Intronic
1049589656 8:143451509-143451531 GGCATTAAAAAGAAGTAGGCCGG + Intronic
1049936682 9:506177-506199 TGCCTTAAAATGAGGGAGAAGGG - Intronic
1051106734 9:13588709-13588731 GACTTTAAAAATGGGGAGCAGGG + Intergenic
1051871903 9:21747660-21747682 GGTATAAAAAAGTGAGAGCATGG + Intergenic
1053012496 9:34642323-34642345 GGCATTAAAATGTGACAGCATGG - Intronic
1054732140 9:68712212-68712234 TCCATGTAAAAGAGGGAGCAAGG - Intronic
1055927588 9:81526522-81526544 GGCAGTAGAAATAAGGAGCAAGG - Intergenic
1056037340 9:82620521-82620543 GGCAGTATAAAGAGGGATCAAGG + Intergenic
1056475817 9:86950027-86950049 GGCAGTAAAATGAGAGAACAGGG - Intergenic
1057708723 9:97417824-97417846 TGCATTAAAAAGGGGGTGAAAGG + Intronic
1058167593 9:101637444-101637466 GGCTGTAAAAATATGGAGCATGG + Intronic
1058900103 9:109434617-109434639 GTAATTATAAAGAGGGGGCATGG + Intronic
1059421324 9:114194303-114194325 GGCATTTAAGCAAGGGAGCAGGG + Intronic
1060602146 9:124885545-124885567 GGCATGGAGAAGAGGCAGCATGG + Intronic
1060689146 9:125640654-125640676 GTCAGTAAAAAGAGTGAGAATGG - Intronic
1061231361 9:129317822-129317844 GGGAGAAGAAAGAGGGAGCATGG - Intergenic
1061506333 9:131033868-131033890 GGCATTAGAGAGATGGAGAAGGG + Intronic
1061571163 9:131478176-131478198 GGCTTTAAAGAGAGGAAGCCTGG + Intronic
1062163556 9:135093590-135093612 GGCATTAAGAAGCGGGAGGGGGG - Intronic
1186193482 X:7088746-7088768 GGGATTTAAAAAAGGGATCAGGG - Intronic
1186576761 X:10775092-10775114 AGAATGAAAAAGAGGGAGGAGGG + Intronic
1186983025 X:14978538-14978560 GGCATTCAAGAGAGGGAATAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187577857 X:20577414-20577436 GGCATGAACATTAGGGAGCAGGG + Intergenic
1187629771 X:21156228-21156250 GGCAGAGAAAAGAGGGAGGAAGG + Intergenic
1188215298 X:27469195-27469217 AGAATTAAAAAGAGAGAACATGG - Intergenic
1188243426 X:27814906-27814928 GGCAATAAAAAGAAGGAACCTGG + Intronic
1189412806 X:40789028-40789050 GGCCTTAAAGATAGGCAGCATGG - Intergenic
1190579743 X:51880890-51880912 GGGATAAAAAAGAGGAAGGAGGG - Intronic
1190750480 X:53357623-53357645 TGCAGAAAAAAGAGGGCGCAGGG + Intergenic
1191898537 X:66018473-66018495 AGAATTGAGAAGAGGGAGCAAGG + Intergenic
1195106380 X:101605865-101605887 GTCATTATAAAGAGGTAGCTGGG + Intergenic
1196268480 X:113681874-113681896 GGCAGGAAAAAGAGAGAGCAGGG - Intergenic
1197431327 X:126370029-126370051 GGAATTGAAAAGTGGGAGCATGG - Intergenic
1198280214 X:135134072-135134094 GGCATTCAGAATGGGGAGCAAGG + Intergenic
1198290744 X:135238442-135238464 GGCATTCAGAATGGGGAGCAAGG - Intergenic
1198434231 X:136599622-136599644 GACAGAAAAAAGAGGGAGGAAGG + Intergenic
1198552527 X:137759677-137759699 GGCATTTTAAAAAGGGAGGAGGG + Intergenic
1201628208 Y:16038933-16038955 CGGAAGAAAAAGAGGGAGCAGGG + Intergenic
1201643804 Y:16205432-16205454 GGCATATAAAAAAGGGAGAAAGG - Intergenic
1201659011 Y:16379889-16379911 GGCATATAAAAAAGGGAGAAAGG + Intergenic
1202044571 Y:20725614-20725636 GGCATTAAAAAGACAGGTCAGGG + Intergenic