ID: 997177238

View in Genome Browser
Species Human (GRCh38)
Location 5:131792135-131792157
Sequence CTGCTGTTCATGATGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997177237_997177238 25 Left 997177237 5:131792087-131792109 CCTGTTATGAAGATATTAAATTC 0: 1
1: 0
2: 2
3: 19
4: 256
Right 997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG 0: 1
1: 0
2: 0
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997177238 Original CRISPR CTGCTGTTCATGATGATAAC TGG Intronic
900009622 1:94385-94407 CTCCTGTTCATGTTGATACACGG - Intergenic
900025732 1:270962-270984 CTCCTGTTCATGTTGATACACGG - Intergenic
900035497 1:404724-404746 CTCCTGTTCATGTTGATACACGG - Intergenic
900057118 1:640474-640496 CTCCTGTTCATGTTGATACACGG - Intergenic
905471332 1:38194297-38194319 CTGCTTTCCATGTTGAGAACAGG + Intergenic
906421306 1:45670098-45670120 CTGCTGCTGATGGTGAAAACTGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917883182 1:179359565-179359587 ATGCTGTTCATCTTGATACCAGG + Intergenic
921453101 1:215333494-215333516 CTATTTTTCTTGATGATAACAGG + Intergenic
922258035 1:223910279-223910301 CTCCTGTTCATGTTGATACACGG - Intergenic
924339229 1:243013058-243013080 CTCCTGTTCATGTTGATACACGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1067286908 10:44913538-44913560 CTGCTGTTAATGCTGAGAATGGG + Intronic
1068307050 10:55224906-55224928 CTGCTTTTCAAGATGAGAATAGG - Intronic
1069465458 10:68634690-68634712 GTACTGTTCATAATGATACCTGG + Intronic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1070932934 10:80273620-80273642 CAGCTGGCCATGATGATGACAGG + Exonic
1075332497 10:121584015-121584037 ATGATGGTGATGATGATAACTGG - Intronic
1076144011 10:128102688-128102710 CTTCTCTTCATGATGACCACGGG + Exonic
1079181145 11:18194475-18194497 ATGCTATTCATGATGTGAACAGG + Intronic
1080913783 11:36633623-36633645 CTATTGTTTATGATGATAACTGG + Intronic
1081822151 11:46009293-46009315 CTTCTGTTCATGATGTTCCCTGG + Intronic
1083078852 11:60070116-60070138 TTGATGATTATGATGATAACAGG + Intronic
1089439220 11:118501094-118501116 CTGTTGAACATGATGAAAACAGG + Exonic
1094224253 12:28027643-28027665 CTGATTTTCAGGATGATAAGTGG - Intergenic
1094440020 12:30464850-30464872 CTGCTGTTCATGTTGGTATTTGG + Intergenic
1101502411 12:105316488-105316510 CTGTTGTTCAGGATCATAAAAGG - Intronic
1107101099 13:36593530-36593552 TTCCTGTTTATGATGATAATAGG + Intergenic
1107161331 13:37232123-37232145 ATGCTGTTAATGATAATAATAGG - Intergenic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1108723102 13:53152041-53152063 CTGCCCTACATTATGATAACTGG - Intergenic
1109893320 13:68648443-68648465 TACCTGTACATGATGATAACAGG - Intergenic
1110652708 13:77960645-77960667 CTGCCAATTATGATGATAACTGG - Intergenic
1112816289 13:103277586-103277608 ATGCTTTTGATGATGATAATAGG - Intergenic
1124411231 15:29439016-29439038 CTGCTGCAAATGATGAGAACTGG + Intronic
1124695653 15:31862277-31862299 CTGCTGTGCATAAGAATAACAGG - Intronic
1125275242 15:37981965-37981987 CTACTGTTCATGAGGGAAACAGG - Intergenic
1126311846 15:47326175-47326197 CTGCTGGCCATGAAAATAACTGG + Intronic
1126671810 15:51122470-51122492 CTGCTGGTCATTTTGAAAACTGG - Intergenic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1129948086 15:79559670-79559692 CTGGTGTTGATGATGATGAAGGG + Intergenic
1130207232 15:81888281-81888303 TTGTTGTTGATGATGATAGCAGG - Intergenic
1131533238 15:93212678-93212700 CTTCTTTTCATGATGTTACCTGG + Intergenic
1134230024 16:12421772-12421794 TTGGTGATGATGATGATAACTGG - Intronic
1139159412 16:64486163-64486185 CTTATGTTGATGATGATATCAGG - Intergenic
1140974221 16:80043770-80043792 CTGTTGTTCATGGTGCTCACTGG + Intergenic
1142454707 16:90212517-90212539 CTCCTGTTCATGTTGATACACGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG + Intergenic
1145046654 17:19622993-19623015 CTGTTGTTCATGATGTCACCTGG + Intergenic
1149143969 17:53467633-53467655 CTGCTGTTCAGGGTGGAAACAGG + Intergenic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1157743187 18:50111702-50111724 CTGCAGTTTATGCTGATAAAGGG + Intronic
1157889321 18:51400012-51400034 CTGCTTTGCATGATGTTGACTGG + Intergenic
1168401059 19:56086650-56086672 CTGTTGTTCATGATCAGAAGGGG - Intergenic
928564136 2:32526051-32526073 CTGTTGTTCAAGGTGATAACAGG + Intronic
933145075 2:78842028-78842050 CTGTTGCTCATGAGGAGAACTGG + Intergenic
933278356 2:80305456-80305478 GTGCTGTTCATGGTGATTACTGG + Intronic
935843011 2:107133943-107133965 TTCCTGTTCATAATGACAACAGG - Intergenic
935870191 2:107439615-107439637 GTGCTATTCATTATGACAACGGG - Intergenic
937797862 2:126046588-126046610 ATGCTGTTCAGGGTTATAACAGG + Intergenic
939720215 2:145640561-145640583 CAGGTCTTCATTATGATAACTGG + Intergenic
940260797 2:151777540-151777562 CTGCTGTTCCAGATGTTAACAGG + Intergenic
941307022 2:163882556-163882578 CTGGTGTTCAGGATAATAAAGGG - Intergenic
944383466 2:199138479-199138501 TTGCTGTTCTTTATGATAATGGG - Intergenic
949086168 2:242157176-242157198 CTCCTGTTCATGTTGATACACGG + Intergenic
1174888025 20:54357461-54357483 CACATGTTCATGATGTTAACTGG + Intergenic
1177160029 21:17537775-17537797 ATGCTGTTCTTGATCATCACTGG - Intronic
1178136339 21:29631584-29631606 CAGCTGTTCATTATGGTAGCTGG + Intronic
1179398981 21:41066683-41066705 CTGCAGTTCATAGTGATAAGAGG - Intergenic
1181858374 22:25799212-25799234 CTGATGGTCATGATGAGAATGGG - Intronic
1184700238 22:46166160-46166182 CAGATGTGCATGATGATCACTGG + Intronic
949933797 3:9101203-9101225 CTGCTGTAGAGGATGATAAAAGG + Intronic
954739354 3:52735237-52735259 CTGATGTTTTTGAAGATAACTGG - Intronic
955163077 3:56484287-56484309 CTGCTGTTGACGATTAAAACTGG - Intergenic
956634064 3:71345795-71345817 CTGCTGTTCATGGTTCTAATAGG - Intronic
956738445 3:72256699-72256721 CTGCTGGTGAGGATGACAACTGG + Intergenic
957958474 3:87219736-87219758 CTGCTGTTGAAGATGAGAAAGGG + Intergenic
958060248 3:88470603-88470625 TTGCTGTTCATTATGACAATTGG + Intergenic
960170132 3:114451331-114451353 CTGCTGTGCATGCTGATGAAGGG + Intronic
960830130 3:121837331-121837353 CTGATGTTCATGCAGATAAGGGG + Intronic
963501891 3:146137749-146137771 CATCTCTTCATGATGATACCTGG - Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG + Intergenic
966712215 3:182981655-182981677 CTGGTGATGATGGTGATAACGGG - Intronic
967288870 3:187900049-187900071 ATGCTAATGATGATGATAACAGG + Intergenic
970149082 4:13069946-13069968 CTGCTGTTGCTGATACTAACAGG - Intergenic
972687609 4:41366181-41366203 CTGATGTTGCTGATGATAAAAGG + Intronic
972857683 4:43127037-43127059 CTTCTGTTCATGATGTTCCCAGG + Intergenic
975740774 4:77426730-77426752 GTGCTGTTCATCAAGATAATGGG - Intronic
977916272 4:102597634-102597656 CTGCTGTGCAGGATGAGAATGGG + Exonic
979237893 4:118422164-118422186 CTCCTGTTCATGTTGATACACGG + Intergenic
980344872 4:131601064-131601086 TTGCTGTTACTGATGAGAACTGG + Intergenic
981209695 4:142088322-142088344 CTGCTTTTAATGTTGATAAATGG + Intronic
983020919 4:162674956-162674978 TTGTTGTTCCTGATGATAGCTGG + Intergenic
984247535 4:177293740-177293762 CAGCTATTCATGATGTGAACTGG + Intergenic
984468936 4:180140661-180140683 TTGTTGTTGATGATGATACCAGG - Intergenic
985420263 4:189778322-189778344 CTACTTTTCATGATCAAAACTGG - Intergenic
986091547 5:4513212-4513234 CTGCTTATCATGAGGGTAACAGG + Intergenic
992350014 5:75919263-75919285 CTGCTGTTCAGGTTGGTCACCGG + Intergenic
993661416 5:90640943-90640965 CTGCTGTTCTGCATGATTACAGG + Intronic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
1002738322 5:181414147-181414169 CTCCTGTTCATGTTGATACACGG + Intergenic
1009054905 6:58322833-58322855 TTGCTGTTTATAATGATAGCGGG + Intergenic
1009236247 6:61127739-61127761 TTGCTGTTTATAATGATAGCGGG - Intergenic
1014308512 6:119770601-119770623 CTGCTGTTTTTGTTGATACCTGG + Intergenic
1015403971 6:132816800-132816822 GTGCTGTACATGATGACAACTGG + Intronic
1017556563 6:155577771-155577793 TTGATGTACATGATTATAACAGG + Intergenic
1019243424 6:170689699-170689721 CTCCTGTTCATGTTGATACACGG + Intergenic
1021531245 7:21648095-21648117 GTGCTGTTGATTATAATAACTGG + Intronic
1021932756 7:25597950-25597972 CTGCTTTCCATGATGATTTCTGG - Intergenic
1022184859 7:27957176-27957198 CTGCTGTTCCTGAAGGTCACAGG - Intronic
1024139569 7:46448269-46448291 CAGATGTTCATGATGAGAAGGGG - Intergenic
1029387973 7:100256294-100256316 CTGCTGTTGATGAAGATGACAGG - Intronic
1032449806 7:132020227-132020249 CAGCTGTTCATGTTGAGACCAGG - Intergenic
1034719192 7:153272807-153272829 CTACTATGCAGGATGATAACTGG + Intergenic
1035504698 8:118459-118481 CTCCTGTTCATGTTGATACGCGG - Intergenic
1036739892 8:11350465-11350487 CTGCTGTTAATGCAGATAAGTGG + Intergenic
1036964522 8:13281091-13281113 TTTCTGTTCATTGTGATAACTGG + Intronic
1038268688 8:26057153-26057175 CTGCTGTTGATGTTGATGATTGG + Intergenic
1039985753 8:42446346-42446368 CTGCTGTCAATGGTGACAACAGG + Intronic
1042572988 8:70186926-70186948 CTGCATTTCATAATGACAACAGG + Intronic
1045100287 8:98837329-98837351 CTGTAGTTCAGGCTGATAACAGG + Intronic
1045149462 8:99387521-99387543 CTGCTGTTCAAAATGTAAACTGG - Intronic
1047207403 8:122813849-122813871 CTGCTAATTATGATGATGACTGG + Intronic
1048056418 8:130870335-130870357 GTGATGTTCATGATGATGATGGG - Intronic
1048389814 8:133952080-133952102 CTGCTTTTCATCATGATTAATGG + Intergenic
1048931727 8:139320715-139320737 CTGCAGTTCATCATTTTAACCGG + Intergenic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1060677889 9:125532711-125532733 CTGCTGTTCATAATGCTGCCAGG + Intronic
1203603613 Un_KI270748v1:38922-38944 CTCCTGTTCATGTTGATACACGG + Intergenic
1188899675 X:35714278-35714300 CTGGTGTTCATTAAGAGAACAGG + Intergenic
1194299999 X:92174413-92174435 ATGCTGATCATAATGTTAACGGG + Intronic
1195380469 X:104266090-104266112 CTGATTGTCATGATGGTAACAGG - Intergenic
1197467568 X:126822710-126822732 CTGCTGTTCAAGATGAGATTTGG + Intergenic
1202385677 Y:24323965-24323987 CTCCTGTTCATGTTGATACACGG + Intergenic
1202485109 Y:25346163-25346185 CTCCTGTTCATGTTGATACACGG - Intergenic