ID: 997177610

View in Genome Browser
Species Human (GRCh38)
Location 5:131796328-131796350
Sequence CTGAGTTGAGAGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997177610_997177617 24 Left 997177610 5:131796328-131796350 CCTCCAGCCTTCTCTCAACTCAG 0: 1
1: 0
2: 3
3: 44
4: 380
Right 997177617 5:131796375-131796397 CTCCACAACGCCAACGGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 45
997177610_997177616 18 Left 997177610 5:131796328-131796350 CCTCCAGCCTTCTCTCAACTCAG 0: 1
1: 0
2: 3
3: 44
4: 380
Right 997177616 5:131796369-131796391 CGCTCTCTCCACAACGCCAACGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997177610 Original CRISPR CTGAGTTGAGAGAAGGCTGG AGG (reversed) Intronic
900460966 1:2801966-2801988 CTATGTGGAGAGGAGGCTGGGGG - Intergenic
900710622 1:4111161-4111183 CTGAGTTGCTAGATGTCTGGGGG - Intergenic
901660893 1:10796950-10796972 CTGAGTTGAGTTGAGGCTAGGGG + Intergenic
903333918 1:22612584-22612606 GGGAGCTGAGAGAAGGCTGCGGG - Intergenic
903368283 1:22818260-22818282 CTGAGGTGAGGGAGGGCTGGAGG - Intronic
903456686 1:23492275-23492297 CTCAGTTGAGAATAGGCTGTAGG - Intergenic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
904438514 1:30514932-30514954 CTGAGTGGATGGAAGGTTGGGGG - Intergenic
904902057 1:33865277-33865299 CTGAGTTGAGACAGGCCTGAGGG + Intronic
905544419 1:38786371-38786393 CTGAGTTGAAGGAATTCTGGAGG + Intergenic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
907663352 1:56413755-56413777 CTGGGTTGAAGGAAGGCTGTGGG - Intergenic
909548056 1:76868755-76868777 CTGAGTGGCGAGCGGGCTGGCGG - Intronic
910032239 1:82741414-82741436 CTGAGTTGAGATTAGGTTGAGGG - Intergenic
910902622 1:92138041-92138063 CTGATTTGAGTGAAGGCGGTAGG + Intronic
912147920 1:106817107-106817129 TTGAGTTGATAACAGGCTGGTGG - Intergenic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
912571649 1:110628686-110628708 ATGACTTGAAAGAAGGCAGGAGG + Intronic
912634863 1:111282601-111282623 CTGAGTTGATGAAAGTCTGGTGG - Intergenic
913023429 1:114810065-114810087 CTGAGTTGAGAAGAAACTGGGGG + Intergenic
913572545 1:120135421-120135443 CTGTGTTGAGAGTAGACTGGGGG + Intergenic
914293387 1:146296335-146296357 CTGTGTTGAGAGTAGACCGGGGG + Intergenic
914554431 1:148747118-148747140 CTGTGTTGAGAGTAGACCGGGGG + Intergenic
915670545 1:157485615-157485637 CTGAGCTCAGAGAAGCCAGGTGG + Intergenic
916650020 1:166826159-166826181 CTGTGTTGAGAACAGGCTGTAGG + Intergenic
917416719 1:174818184-174818206 ATGAGCAGAGAGAAGGGTGGAGG + Intronic
917778935 1:178370241-178370263 CTGAGTCGAGAGGAGTCTGGGGG + Intronic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
918049475 1:180961823-180961845 CAGACTTCAGAGAATGCTGGGGG - Intergenic
918555190 1:185790791-185790813 CTGGGTTGAGAGGAAACTGGAGG + Intronic
918720749 1:187849869-187849891 CTGTGTTGAGTGAAGGATGATGG - Intergenic
919917989 1:202150865-202150887 CAGAGTGGAGAGAAGACTGTGGG - Intronic
919941235 1:202287824-202287846 CCCAGGTGAGAGAAGGATGGCGG - Intronic
920707999 1:208268921-208268943 CTGTCTGGAGACAAGGCTGGTGG + Intergenic
921566468 1:216727597-216727619 ATGAATTGATAGAGGGCTGGTGG - Intronic
921695811 1:218208348-218208370 CTGAGGTGAGAGGATGCTTGAGG - Intergenic
921791401 1:219294696-219294718 CTGAGCTGTGGGAAGGCTTGAGG - Intergenic
922079583 1:222282554-222282576 CTGGGATGAGAGAGGGCTTGTGG - Intergenic
924759430 1:246970420-246970442 CTGAGTTGAGGAAAGACTGGAGG + Intronic
924928046 1:248702620-248702642 CTGAGATGAGAGTAGGCTCTAGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1064581378 10:16796413-16796435 CAGTGTTGAGAGAAAGGTGGAGG - Intronic
1067026851 10:42849931-42849953 TAGAGAGGAGAGAAGGCTGGGGG + Intergenic
1067076169 10:43184586-43184608 CTGATTTGAGAAAAGGGAGGAGG + Exonic
1067242234 10:44506715-44506737 CTGTGTTGGCAGAGGGCTGGGGG + Intergenic
1067309748 10:45101754-45101776 CTGTGTTGAAAATAGGCTGGAGG - Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068388127 10:56359013-56359035 CTGAGCTGGGTGTAGGCTGGAGG - Intronic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1068984336 10:63093118-63093140 CTGAGTAGAGAGTAGAATGGTGG - Intergenic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069903770 10:71720457-71720479 CTGGGGAGAAAGAAGGCTGGGGG - Intronic
1069979869 10:72244948-72244970 CTGTGTTGAGAGATGCCTTGGGG - Intergenic
1070439544 10:76429876-76429898 CTGCGTTGAGAGAAGTGTGCTGG + Intronic
1070807864 10:79281166-79281188 CTGAGTTGAGCTAAGGCATGAGG + Intronic
1071107359 10:82113976-82113998 GGGAGTAGGGAGAAGGCTGGTGG - Intronic
1071449071 10:85777321-85777343 TTGAGTGGACAGTAGGCTGGAGG - Intronic
1072533839 10:96344504-96344526 CTGGGATAAGAGAAAGCTGGAGG + Exonic
1073420644 10:103421211-103421233 CTGTGTTCAGAGAGGGCTTGGGG + Intronic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1073549137 10:104381253-104381275 CTTAGGAGAGAGAAGGCTCGAGG + Intronic
1075709123 10:124521342-124521364 CTGAGGTGCCAGAGGGCTGGGGG - Intronic
1075894576 10:125983876-125983898 CTGAGTTGGGAACAGGCTGTAGG + Intronic
1076128768 10:127996630-127996652 CTGACATGAAACAAGGCTGGAGG - Intronic
1078531618 11:12140877-12140899 CTCAGTCTAGAGAAGGTTGGTGG - Intronic
1078564584 11:12403425-12403447 CTGGGCACAGAGAAGGCTGGGGG - Intronic
1079033739 11:17005090-17005112 CTGAGGTGACAGAGGGCTGTAGG - Intronic
1079364383 11:19796653-19796675 CTCTGTGGAGGGAAGGCTGGTGG + Intronic
1079824750 11:25176678-25176700 CTGAGGTGGGATAAGTCTGGAGG - Intergenic
1081590591 11:44420238-44420260 TAGAGTTGAGAGAAGGCCTGGGG - Intergenic
1081708317 11:45199743-45199765 CTGAGTAGAGAGCAGGCTGTGGG - Intronic
1082796645 11:57382657-57382679 CTGGGGTGACAGAAGACTGGTGG - Intergenic
1085835568 11:79952508-79952530 TTGAGTTGAGTGAAACCTGGAGG - Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1087592492 11:100208830-100208852 CTCAGTTGAGTGACTGCTGGTGG + Intronic
1088106207 11:106209440-106209462 ATGAGCTGAGAGAAGGATGGTGG + Intergenic
1090063096 11:123480495-123480517 GTGGGTAGAGAGAATGCTGGAGG + Intergenic
1090332771 11:125944435-125944457 CCCAGCTGAGAAAAGGCTGGGGG + Intergenic
1091556051 12:1574350-1574372 CTGGGGTGAGAGGAGGCTGGTGG + Intronic
1091556079 12:1574431-1574453 CTGGGGTGAGGGGAGGCTGGTGG + Intronic
1091963603 12:4719991-4720013 CTGGGTGGAGAGAAAGCTGTTGG + Intronic
1092254702 12:6920142-6920164 GTGAGTAGAAAGAAGGCTGAGGG + Intronic
1093748658 12:22772830-22772852 CTGGGTTGAGTGAAGGCTCCAGG - Intergenic
1096242492 12:49966930-49966952 CTAAGTGTGGAGAAGGCTGGGGG - Intergenic
1096757934 12:53815612-53815634 CTGAGTTCAGAGGGGGCTGAGGG + Intergenic
1096790975 12:54044748-54044770 TAGAGATGTGAGAAGGCTGGGGG - Intronic
1097032106 12:56097226-56097248 CCAAGGTGAGAGAAGCCTGGAGG + Exonic
1097102437 12:56599106-56599128 GTGAGTTGAGTGAATCCTGGGGG - Intronic
1097589706 12:61559452-61559474 CCCAGTTGATAGAAGGCAGGAGG - Intergenic
1098222363 12:68283732-68283754 CTGATTTCAGAGGAAGCTGGAGG + Intronic
1098222383 12:68283990-68284012 CGGATTTGAGAGGAAGCTGGAGG + Intronic
1100293220 12:93236636-93236658 ATGAGATGACTGAAGGCTGGGGG - Intergenic
1101325977 12:103716320-103716342 CTGTCTGGAGAGCAGGCTGGGGG + Intronic
1101910240 12:108856128-108856150 CTGTGTTTAGAGAAGACTGGAGG - Intronic
1102220566 12:111191673-111191695 ATGAGATGGGAGAAGGCAGGTGG - Intronic
1102227657 12:111240337-111240359 CAGACTAGAGAGAGGGCTGGAGG - Intronic
1102332326 12:112044806-112044828 CTGAGGTGAGAGACTGCTTGAGG + Intronic
1103080014 12:118016562-118016584 GAGAGTTCAGAGCAGGCTGGAGG + Intronic
1105303077 13:19152341-19152363 CTGTCTTCAGAGAAGGCTGGGGG - Intergenic
1106098094 13:26668276-26668298 CTGAGCTGGGAGAAGGCAGGAGG - Intronic
1106715247 13:32381748-32381770 CTGTGTTGAGAATAGGCTGTAGG + Intronic
1107646489 13:42499364-42499386 GTGAGTTGATAAAAGGCTGTAGG - Intergenic
1109838390 13:67888882-67888904 ATGATTTGACAGAGGGCTGGAGG - Intergenic
1113339103 13:109404645-109404667 CTGAGATGGGAGCAGGCTCGTGG - Intergenic
1113373605 13:109744250-109744272 AGGACTTAAGAGAAGGCTGGAGG + Intergenic
1113827601 13:113268460-113268482 CTGAATTCAGAAAGGGCTGGAGG + Intergenic
1115177591 14:30582068-30582090 CATAGCTGACAGAAGGCTGGAGG - Intronic
1115263001 14:31472657-31472679 CTGACTGGAGGGAAGGCTTGTGG + Intergenic
1115739637 14:36374371-36374393 CTGAGGTGAGAGTAGAGTGGTGG + Intergenic
1116039309 14:39666607-39666629 CTCAGCTGAGGGAGGGCTGGAGG - Intergenic
1117014538 14:51505301-51505323 CTGAGGTGAGAGATTGCTTGAGG - Intronic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119792632 14:77366472-77366494 CTAAATTGTTAGAAGGCTGGAGG - Intronic
1119945585 14:78690213-78690235 CTAAGATGGGAGAAGGTTGGAGG - Intronic
1120571061 14:86116925-86116947 CTGACATGAGTTAAGGCTGGGGG + Intergenic
1122205823 14:100147506-100147528 CTGTGTAGAGCAAAGGCTGGAGG - Intronic
1122357346 14:101131638-101131660 CTCAGTTCAGAGCTGGCTGGGGG + Intergenic
1122594009 14:102876615-102876637 ATGAGTTGAGGGAAGGCCTGTGG - Intronic
1122594025 14:102876722-102876744 ATGAGTTGAGGGAAGGCCTGTGG - Intronic
1122594048 14:102876901-102876923 ATGAGTTGAGGGAAGGCCTGTGG - Intronic
1122594057 14:102876972-102876994 ATGAGTTGAGGGAAGGCCTGTGG - Intronic
1122594075 14:102877115-102877137 ATGAGTTGAGGGAAGGCCTGTGG - Intronic
1122619957 14:103050422-103050444 CTGAGTGGGGAGTGGGCTGGAGG + Intronic
1122979718 14:105185990-105186012 CTGAGTTGAGGGGAAGCTGGAGG + Intergenic
1123022166 14:105404765-105404787 CTGAGGTGAGAGTGTGCTGGGGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1123428566 15:20193892-20193914 CTGAGGTGTGAGTAGGGTGGCGG - Intergenic
1124067742 15:26361844-26361866 TTGAGTGGAGAGAAGGGTGCCGG + Intergenic
1124867117 15:33503381-33503403 TCGACTTGAGGGAAGGCTGGTGG - Intronic
1125368507 15:38945018-38945040 CTGAGATGAGCAAAGACTGGTGG + Intergenic
1125827687 15:42690223-42690245 CTGGGTTGACAGAAGTCTGCAGG + Exonic
1125944835 15:43704414-43704436 CTGAGTTGGGAGCAGGAGGGAGG - Intergenic
1126325674 15:47474194-47474216 CTGAGTTGAGAAGAAGCTGAGGG + Intronic
1126993053 15:54405977-54405999 CTATGTTGAGAGAAGTGTGGGGG + Intronic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128276306 15:66356621-66356643 GTGAGGTGAGAGCTGGCTGGCGG - Exonic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1128991663 15:72265829-72265851 CTGAGTTGTTAAAAGGCTAGAGG - Intronic
1129958795 15:79664409-79664431 AGGAGATGAGAGGAGGCTGGAGG + Intergenic
1132037188 15:98494189-98494211 CAGAGTGGTGAGAAGGCAGGAGG + Intronic
1132688485 16:1172049-1172071 CAGAGTTCAGTGAAGGCTGCTGG - Intronic
1132982570 16:2745999-2746021 CTGAGCTGTGTGAAGGCTGCAGG + Intergenic
1132986296 16:2769301-2769323 CTGAGTTGAAAGGTGGGTGGGGG + Intronic
1136154431 16:28373742-28373764 CTCAGTCAAGAGAAGGGTGGGGG - Intergenic
1136208659 16:28741522-28741544 CTCAGTCGAGAGAAGGGTGGGGG + Intergenic
1136619053 16:31415908-31415930 CTGGGTTGGGCGAGGGCTGGGGG - Intronic
1136855751 16:33655840-33655862 CTGAGGTGTGAGTAGGGTGGCGG + Intergenic
1137575135 16:49594381-49594403 CTCTGTTGAGAGAGGCCTGGGGG - Intronic
1137748360 16:50840353-50840375 CTGATTCGAGAGGAGGCTGGAGG + Intergenic
1138470672 16:57233343-57233365 CAGAGATGAGAGAAGACTGAGGG - Intronic
1139611613 16:68063033-68063055 CTGAGAAGAGAGGAGGCTGGAGG - Intronic
1139716900 16:68820831-68820853 CTGAGGTGGGAGATGGCTTGAGG + Intronic
1141639398 16:85332782-85332804 CTGAGGAGAGAAGAGGCTGGAGG - Intergenic
1141714888 16:85721158-85721180 ATGAGTAGATTGAAGGCTGGAGG - Intronic
1203117337 16_KI270728v1_random:1504321-1504343 CTGAGGTGTGAGTAGGGTGGCGG + Intergenic
1142806675 17:2375091-2375113 CTGGGTGGAGAGAAGCCTAGAGG - Intronic
1143328512 17:6117458-6117480 GGGAGGTGAGAGGAGGCTGGGGG + Intronic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143953698 17:10653111-10653133 CTGAGGTGAGAGACGGATGTCGG + Intronic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144655113 17:17030167-17030189 GGGAGTGGACAGAAGGCTGGGGG - Intergenic
1144762685 17:17716210-17716232 CTGAGTTGGGAAGTGGCTGGAGG + Intronic
1147155997 17:38544752-38544774 AAGAGCTGAGAGAAGGCCGGTGG + Intronic
1147320511 17:39643065-39643087 CTGTGTTGAGAACAGGCTGAAGG + Intronic
1147477220 17:40723687-40723709 CTGTGTTGAAAGAAGCTTGGGGG - Intergenic
1147505190 17:41009097-41009119 TTGAGTTGAGAGAAGTCTGTTGG + Exonic
1147690250 17:42310417-42310439 TTGAGTGGAGAGCAGGCTGGAGG + Intronic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1150656688 17:67044250-67044272 CTGAGTTGGGAGAGGGCGAGAGG - Intergenic
1151161840 17:72172527-72172549 CTGAGTGGAGAGGATGCTTGGGG + Intergenic
1151277393 17:73045907-73045929 CTGAGCTGAGAGAGTGCTGATGG - Intronic
1152005592 17:77678422-77678444 ATGGGTTGAGTGAAGGCTTGTGG - Intergenic
1152421353 17:80195071-80195093 CTGACTGGAGAGGAGGCAGGAGG - Intronic
1153527827 18:6014597-6014619 CAGAGGTGAGAGGAGCCTGGAGG + Intronic
1153767192 18:8385805-8385827 CTGTGTTGAGAATAGACTGGAGG + Intronic
1155132273 18:22949816-22949838 CAAAGGTGAGAGAAGGCTGTGGG - Intronic
1156174023 18:34521153-34521175 CTGGGATGAGGGAAGCCTGGAGG - Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156840697 18:41606732-41606754 CTGTACTGAGAGAAGCCTGGTGG - Intergenic
1157195494 18:45617359-45617381 CTGGGGTTAGAGATGGCTGGTGG - Intronic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1158239311 18:55359309-55359331 CTGAAATGAAAGAAGACTGGGGG - Intronic
1159960334 18:74550534-74550556 CTGGAATGAGTGAAGGCTGGGGG + Intronic
1160340379 18:78084281-78084303 CTGAGGTGGGAGAGGGCTGCAGG + Intergenic
1160483045 18:79260639-79260661 ATGAGATGAGAGAAGCCTGTTGG + Intronic
1160523560 18:79522625-79522647 CTGAGGTGAGGGAAGGCTGGGGG - Intronic
1161152091 19:2714819-2714841 CTGAGGTGGGAGAGGCCTGGAGG + Exonic
1162470171 19:10868349-10868371 CTCAGTTGACAGCAGGCTGGGGG - Intronic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162796808 19:13091317-13091339 CTGAGTCCAGAGAAAGTTGGTGG + Intronic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1165370654 19:35403730-35403752 CTGAGGTGGGAGGAGGCTGGAGG - Intergenic
1165413434 19:35676512-35676534 CTGACTTGAGAGAGAGTTGGGGG - Intronic
1165553842 19:36612132-36612154 CTGAGTTGGAAGAGGCCTGGTGG - Intronic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1167486408 19:49765725-49765747 CTGAGATTAGAAAAGGCTGATGG + Intergenic
1167658603 19:50782575-50782597 CTGTGTTGAGCGCAGGATGGGGG - Intergenic
1167693628 19:51001865-51001887 CTGAGAGGGGAGGAGGCTGGGGG + Intronic
1168168810 19:54573215-54573237 CTGAGGTGGGTGAAGGCTAGAGG - Intronic
1168332947 19:55580357-55580379 CTGAGTTGGGAGGGGGCTAGGGG + Intronic
1168377748 19:55894616-55894638 CTGGGTTGAGATAAGACAGGAGG - Intronic
1168469777 19:56630562-56630584 CTGTGTGGAGAACAGGCTGGGGG + Intergenic
925034527 2:675692-675714 CTGCGCTGGGAGAAGGCTGTGGG - Intronic
925188854 2:1867185-1867207 CTGAGTGGAGAAAAGGGTGTGGG + Intronic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
925459893 2:4052142-4052164 CAGATTGGAGAGGAGGCTGGAGG - Intergenic
925634810 2:5932917-5932939 CTCAGGTGAGACAAGGCTCGGGG + Intergenic
925965898 2:9065665-9065687 CAGAGTTGAGGGAAGAATGGTGG - Intergenic
926134394 2:10326323-10326345 GTGAGGTGACAGAAGGCGGGAGG + Intronic
928308254 2:30189204-30189226 CTGACTTGAGAAAGGTCTGGAGG + Intergenic
928441766 2:31297960-31297982 CTGAGTTGTTAAAAGGCTGAAGG - Intergenic
932329990 2:70893046-70893068 TTGAGGAGATAGAAGGCTGGGGG + Intergenic
934568025 2:95351305-95351327 CTGTGTTGAGAGCAGACTTGGGG + Intronic
935103612 2:100019780-100019802 CTGAGGTGAGGGAAGGTTGGAGG - Intronic
935557986 2:104531382-104531404 CTGCGTTGGGAGTAGTCTGGGGG - Intergenic
935788448 2:106570030-106570052 CTGAGGTGATTGAAGGCTGCTGG + Intergenic
935832861 2:107018766-107018788 CAGAGTTGAGACAAGTGTGGAGG + Intergenic
936471003 2:112798490-112798512 CTAAGTTGAGAAAGAGCTGGGGG - Intergenic
936835391 2:116703594-116703616 GTGAGTAGAGGGAAGGGTGGAGG - Intergenic
936962361 2:118088811-118088833 CTGAGCGGGAAGAAGGCTGGAGG + Intronic
937070198 2:119057407-119057429 CTGAGGGCAGGGAAGGCTGGGGG - Intergenic
937351913 2:121171205-121171227 CTGAGTTGAGATGGGGCTGAGGG - Intergenic
938247998 2:129793843-129793865 CTGAGTGTAAAGAAGGCTGGGGG - Intergenic
938291367 2:130152523-130152545 CTGCCTTCAGAGCAGGCTGGAGG - Exonic
938465177 2:131520436-131520458 CTGCCTTCAGAGCAGGCTGGAGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
940901268 2:159128612-159128634 CTGAGTTGAGGCACGGCTCGGGG - Intronic
940924216 2:159345680-159345702 ATGAGTTGGGAAAAAGCTGGAGG + Intronic
943085831 2:183310115-183310137 CTGAGTTGAGAAAAGGCAACTGG + Intergenic
943142244 2:183997527-183997549 CTGTGTTGAGAAAATGCTGGGGG - Intergenic
946050088 2:216855287-216855309 CTGAGTTTAGGAATGGCTGGAGG + Intergenic
948098173 2:235353005-235353027 CTGTGTTGAGAAAAGAGTGGGGG + Intergenic
948355891 2:237376702-237376724 ATGAGTTGAGGGTAGGCTGCTGG - Intronic
1169476117 20:5932720-5932742 CTGGGTTGAGTGATGGCTGTAGG + Intergenic
1169883654 20:10374202-10374224 CTGTGTTGAGAGCAGACTGTGGG + Intergenic
1170844647 20:19952138-19952160 TTGAGTTGAGACAACTCTGGGGG - Intronic
1172556883 20:35849914-35849936 CTGAGTGTTGAGCAGGCTGGTGG + Intronic
1173163248 20:40668277-40668299 CTGACTCGAGTCAAGGCTGGTGG + Intergenic
1173350147 20:42237430-42237452 CTGTGTTCACAGAAGTCTGGGGG + Intronic
1175440337 20:58986226-58986248 CTGTATTGGGAGGAGGCTGGGGG + Intronic
1175645483 20:60667238-60667260 CTGACATCAGAGAAGGATGGAGG - Intergenic
1175854618 20:62113811-62113833 CTGAGGTGGGAGAATGCAGGAGG + Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1178342082 21:31794220-31794242 TTGAGTGGAGAGAAGGATGGCGG + Intergenic
1179010205 21:37550810-37550832 CTGAGAGGGGAGAAAGCTGGGGG + Intergenic
1179284361 21:39964068-39964090 CTGAATTGAGAGAAGACTGAGGG - Intergenic
1180750146 22:18118973-18118995 CAGAAGTGAGAGCAGGCTGGGGG + Intronic
1181435317 22:22907002-22907024 CTGAGCTGAGGCCAGGCTGGAGG - Intergenic
1181441103 22:22935579-22935601 CTGAGATGGGAGTAGGGTGGGGG + Intergenic
1181510360 22:23386208-23386230 CTGGGTTGAGAGAGAGATGGGGG - Intergenic
1181545091 22:23598112-23598134 CTGAGGTGAGAGTAGGGTGGGGG - Intergenic
1181809586 22:25395301-25395323 CTGAGTGGAGGGGAGGGTGGGGG + Intronic
1181815220 22:25431770-25431792 CTGAGGTGAGAGTAGGGTGGGGG + Intergenic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183150881 22:36036560-36036582 ATGACTTGAGAGCAGGGTGGGGG - Intergenic
1183247544 22:36705337-36705359 GGGAGTGGAGAGAAGGTTGGGGG + Intergenic
1184103522 22:42354163-42354185 CTGAGTTGGGAATAGACTGGGGG - Intergenic
1184520365 22:44990238-44990260 CTCAGTGGAGAGAAGCCTGAAGG - Intronic
1185160940 22:49229465-49229487 TTGAGTTGAGAGCAGGCAGCAGG - Intergenic
1185302184 22:50087658-50087680 CTGGGTGGAGAGCAGGCTGGGGG + Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949399622 3:3652224-3652246 CTGAGTTGAGAGTAGGAGGTAGG - Intergenic
950104516 3:10379674-10379696 CTGGGTTGAGAGAAGGCAAAGGG + Intronic
950394024 3:12719793-12719815 CTGAGGTCTTAGAAGGCTGGAGG + Intergenic
950681967 3:14591714-14591736 CTGATTTCAGAGAAAGCTGTGGG + Intergenic
951420789 3:22482364-22482386 GTGAGCTGAGGGAAGGCAGGAGG - Intergenic
951575814 3:24112709-24112731 CTGAGTTCAGAGAAGGCAAGAGG - Intergenic
951666255 3:25127310-25127332 AGGAGTTGATAGAAGGCTGGTGG - Intergenic
951840819 3:27032211-27032233 CTGAGTGGAGAAAAGGTGGGGGG - Intergenic
952340077 3:32438116-32438138 CTGAATTCAGAGAGGACTGGAGG - Intronic
953373082 3:42406567-42406589 GGGAGTTGAGAGGAGGCTGCAGG - Intronic
955224535 3:57050076-57050098 GTAAGATGAGAGAAGGATGGAGG - Intronic
958827682 3:99051451-99051473 CCCATTTGAGTGAAGGCTGGTGG + Intergenic
958891496 3:99788416-99788438 CTGAATTGATGGAAGGCTGAAGG + Intronic
960550402 3:118969923-118969945 CAGACTTGACAGAAGGCTTGTGG - Intronic
961281331 3:125767318-125767340 GAGAGTTGAGAGAAGGCAGATGG + Intergenic
961564607 3:127754570-127754592 CAGAGAGGAGAGAGGGCTGGCGG + Intronic
962447131 3:135476399-135476421 CTGAGTTGACTGATGGCTGGGGG + Intergenic
962923242 3:139969751-139969773 CTCATTTGAAAGGAGGCTGGAGG - Intronic
964096425 3:152936539-152936561 TTGTGTTGAGACAAGGCTGCAGG - Intergenic
967497318 3:190156160-190156182 CAGAAGTGGGAGAAGGCTGGAGG + Intergenic
968287235 3:197516033-197516055 CTGAGGAGAGTGAAGACTGGGGG - Intronic
968672602 4:1859800-1859822 GTGGGGTGAGAGGAGGCTGGAGG - Intergenic
968771169 4:2508304-2508326 ATGAGTTGAGAGATGGATAGAGG - Intronic
968862558 4:3184429-3184451 CTGAGTTGAGAATAGCCTTGAGG + Intronic
969081295 4:4620641-4620663 CTAAGTTGAGAGAGTTCTGGGGG - Intergenic
969405971 4:6992025-6992047 CTGAGGGGAGAGAAAGCTAGTGG + Intronic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
972075451 4:35080309-35080331 ATGAGCTGAGAGCAGACTGGTGG + Intergenic
972212038 4:36849992-36850014 CTGAGTTGAGAAAAGTTTGGAGG + Intergenic
972258823 4:37387620-37387642 CTGGGTGGAGAGCAGGCTGCGGG - Intronic
972541044 4:40039655-40039677 CTGAGGTGAGAGAATCCTGGAGG + Intergenic
972795785 4:42417944-42417966 CAGTGATGAGAGAAGGCTGAAGG + Intronic
975683755 4:76899687-76899709 CTGGGTTGAGAGAGGGATAGTGG + Intergenic
975873982 4:78813743-78813765 TTGTGTTGGGAGAAGGATGGAGG - Intronic
976249442 4:83035209-83035231 CTGAGCTGGGAGAAAGATGGCGG + Exonic
977101858 4:92826156-92826178 ATGAGTTCAGAGAAGGTAGGAGG - Intronic
977588392 4:98800553-98800575 CTGAGTGGAGAGATGACTGTAGG + Intergenic
977927463 4:102717508-102717530 CTGAGGTGGGAGGAGCCTGGAGG - Intronic
978621974 4:110641639-110641661 AGGAGTTCAGAAAAGGCTGGCGG + Intronic
980058904 4:128107244-128107266 ATCAGTTGAGAGAAGTCTGTTGG - Exonic
981563490 4:146073320-146073342 CTGGGATGGGAGAAGGCTGTGGG - Intergenic
984272750 4:177567661-177567683 CAGAGAAGAGAGATGGCTGGAGG + Intergenic
985019552 4:185673129-185673151 CTGAGCAGAGAGTAGACTGGTGG + Intronic
985867200 5:2523365-2523387 CTGAGAGGAGAGCAGGCTGCTGG - Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
986034921 5:3928083-3928105 CTGAGTTGAGTGAAGAATGTGGG - Intergenic
986171803 5:5320451-5320473 CTGAGTGAAGAGGAGGCTGCAGG + Intergenic
987630832 5:20469707-20469729 CTGAGTGGAGAATAGACTGGAGG - Intronic
987744575 5:21953182-21953204 CTGAGTTCAGATAAGAGTGGGGG - Intronic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
988986957 5:36629861-36629883 CTGTGGTCAGAGAAGGCTGATGG - Intronic
990693886 5:58393361-58393383 CTGAGTTCTGAGAAGGGAGGAGG + Intergenic
991764781 5:69963304-69963326 CTGAGTTCAGATAAGAGTGGGGG - Intergenic
991782543 5:70154849-70154871 CTGAGTTCAGATAAGAGTGGGGG + Intergenic
991844013 5:70838375-70838397 CTGAGTTCAGATAAGAGTGGGGG - Intergenic
991874986 5:71155162-71155184 CTGAGTTCAGATAAGAGTGGGGG + Intergenic
992037947 5:72799587-72799609 GTCAGGAGAGAGAAGGCTGGAGG + Intergenic
992171069 5:74102656-74102678 CTGAGACTAGATAAGGCTGGTGG - Intergenic
994982718 5:106897648-106897670 CTGAGTTAAGAGAAAGCTTCAGG + Intergenic
995434840 5:112123789-112123811 ATGACTTAGGAGAAGGCTGGTGG - Intergenic
995586490 5:113654032-113654054 ATGAGTTGACTGATGGCTGGAGG + Intergenic
995997344 5:118317821-118317843 CTGAGCTGAAAGAAGGTTGGGGG - Intergenic
996571312 5:124935253-124935275 CTGAAGTGAGAGAAGTCTCGTGG - Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
998463435 5:142325456-142325478 CCGGGTTGAGAGCAGGGTGGTGG + Intronic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
1000337335 5:160251595-160251617 CTGATTTGAGAGAGGGAAGGAGG + Intergenic
1000623642 5:163513221-163513243 CTGAGGTGAGACAATGCTTGAGG - Intronic
1001143814 5:169166932-169166954 CTGAGGTGAGAGGATGCTTGAGG + Intronic
1001548326 5:172584403-172584425 CTGAGATTAGAGAAGGTGGGAGG + Intergenic
1001806504 5:174591313-174591335 CGGAGAGGAGAGAAGGCAGGTGG - Intergenic
1002324139 5:178394420-178394442 GTGAGCTGAGAGAGGGCTGGTGG - Intronic
1002606381 5:180385296-180385318 CGGAGTGGAGAGAAGGCGGTGGG + Intergenic
1003307947 6:4946176-4946198 CAGCTTTGAGAGATGGCTGGTGG - Intronic
1003634993 6:7823986-7824008 CTGTGTAGAGAATAGGCTGGAGG + Intronic
1004014837 6:11722892-11722914 CTGAGTTGGGAGGAGGTGGGAGG + Intronic
1004199778 6:13536859-13536881 CTGAATTGACAGGAGGCTGATGG - Intergenic
1004280734 6:14277527-14277549 CTGTGTTGAGAGCAGACTGCAGG - Intergenic
1004982574 6:21042556-21042578 CTGACTTGAGTGGAGGCAGGTGG - Intronic
1005619678 6:27608326-27608348 ATGTCTTGAGAGAAAGCTGGTGG - Intergenic
1006393693 6:33773465-33773487 CAGTGATGAGAAAAGGCTGGGGG - Intronic
1006788631 6:36684361-36684383 ATGAGTTGGGAGGAGGCAGGCGG + Exonic
1006928631 6:37673801-37673823 CTGCGTTCAGGCAAGGCTGGAGG - Intronic
1007061262 6:38942753-38942775 CTGAGGTGTGGGAAGCCTGGAGG + Intronic
1007260279 6:40558545-40558567 AAGAGCAGAGAGAAGGCTGGAGG + Intronic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1011658922 6:89577287-89577309 CAGAGTTGAGAGAAGTTAGGAGG - Intronic
1012320626 6:97840348-97840370 CTTTGGTGAGATAAGGCTGGAGG + Intergenic
1012804877 6:103881280-103881302 CTGAATTGACAGAAAACTGGAGG + Intergenic
1013608094 6:111769234-111769256 CTCAGTTAAGTGAAGGCTAGAGG - Intronic
1013631821 6:111993135-111993157 CTGTATGGAGAGAAGGCTGTGGG + Intergenic
1013982593 6:116150020-116150042 AGGAGCTGAGAGAAGGCTTGTGG + Intronic
1014086168 6:117346912-117346934 ACTAGTTGCGAGAAGGCTGGGGG - Intronic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1016662800 6:146600392-146600414 GGGAGTGGAGAGAAGGCTAGTGG - Intronic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1017528396 6:155263365-155263387 CTGAGTTTGGAAAAGGCTGGCGG - Intronic
1018143702 6:160863958-160863980 CTGAATTGCGCGGAGGCTGGAGG + Intergenic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1020188006 7:5973709-5973731 CTGATTTCACAGAAGGGTGGAGG - Intronic
1020294912 7:6751060-6751082 CTGATTTCACAGAAGGGTGGAGG + Intergenic
1021038902 7:15836832-15836854 CAGAGTTGAGAGAAGGCATTAGG + Intergenic
1021757967 7:23873834-23873856 CTGAGATGAGAGAAGACGGCAGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1023038666 7:36153852-36153874 CAGAGTTGAGAGAGGCCTGGAGG + Intronic
1023583619 7:41706480-41706502 CTGAAATGACACAAGGCTGGGGG + Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023937806 7:44751609-44751631 CTGCGGAGACAGAAGGCTGGTGG + Intronic
1025034777 7:55587326-55587348 CACAGATGAGAGAGGGCTGGGGG - Intergenic
1025054389 7:55753168-55753190 CTGAGTTGAGAAAAGACTATGGG - Intergenic
1025607233 7:63048033-63048055 CTGAGTTGAGAGGAGGCACAGGG - Intergenic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1028470118 7:91196826-91196848 GTGAGAAGAGAGAAGGCTGCTGG + Intronic
1029126962 7:98301153-98301175 CTGTGTTGACAGAAGTCTGCTGG + Intronic
1029524125 7:101084948-101084970 ATGAGTTTAAAGAAGGCGGGAGG - Intergenic
1033061780 7:138116396-138116418 GTGTGTTGAGGGAAGGTTGGTGG - Intronic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033849082 7:145472466-145472488 CTGAGTAGACAGAAGACTGTGGG - Intergenic
1035544976 8:473371-473393 CTGAGTTTAGAGAGGACTGCTGG - Intergenic
1036114028 8:5938847-5938869 CTGAGTTCAGAGATGTCTGCAGG - Intergenic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036777698 8:11624993-11625015 CTGAGTTGAGAGGAGGCACAAGG + Intergenic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1038244042 8:25837664-25837686 CTGACGTCAGAGAAAGCTGGGGG + Intergenic
1038530952 8:28317621-28317643 CTGTGTCGAGAGGAGGCTGCTGG + Intronic
1039738301 8:40356077-40356099 CTTAGGTGAGAGAAGGGTAGTGG + Intergenic
1039779154 8:40766904-40766926 TTGAGTTAAGAGGAGGCTGCAGG - Intronic
1040599038 8:48866339-48866361 CGGAGGTGAGAGGTGGCTGGGGG - Intergenic
1040759717 8:50824732-50824754 CTCAGTGGAGAGGAGGCTGAGGG + Intergenic
1041268622 8:56089163-56089185 ATTACATGAGAGAAGGCTGGAGG + Intergenic
1042672925 8:71284014-71284036 CTGAGGTGGGAGCAGGCAGGTGG - Intronic
1044332767 8:90940961-90940983 CTTACTTTAGACAAGGCTGGGGG + Intronic
1044744938 8:95362675-95362697 CTGTGTTGAGAACAGGCTGTAGG + Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1047715862 8:127594586-127594608 CTGTGTTCAGAGAAGGTTGAAGG + Intergenic
1049401334 8:142428787-142428809 CTGTGTGGGGAGATGGCTGGGGG + Intergenic
1049549207 8:143248959-143248981 CTTTGTTGAGAGGAGGTTGGTGG - Intronic
1050683775 9:8144411-8144433 CTAAGGTGAGAGAAAGCTTGGGG - Intergenic
1051720408 9:20030910-20030932 GTGAGGTGAGAGTAGGGTGGGGG - Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1055319422 9:75067838-75067860 CTGTGTTGTGAGAAGCCTGTTGG - Intronic
1055731063 9:79279679-79279701 CAGAGTTGGCAGAAGGCTAGGGG + Intergenic
1056271804 9:84954562-84954584 CTGTGTTGAGCGGAGGTTGGAGG + Intronic
1058081119 9:100702075-100702097 CTGACTAGAGAGAAGGGTGTAGG - Intergenic
1058804494 9:108577872-108577894 CTGAGTGGAGAGCAGATTGGAGG - Intergenic
1059545412 9:115171033-115171055 CTGAGTTGACAGAAGAGTGAGGG + Intronic
1059561374 9:115338177-115338199 CTGAGAGGAAAGACGGCTGGTGG + Intronic
1060672705 9:125484096-125484118 CTGAGTTAAGAACAGGCAGGTGG + Intronic
1061723859 9:132570750-132570772 CTGAGGTGAAAGAAGGCAGGGGG - Intronic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1061963068 9:133998147-133998169 ATGAGTGGAGGGATGGCTGGAGG - Intergenic
1186133676 X:6496292-6496314 CTGAGTTGTGAATAGGCTGCCGG - Intergenic
1189556751 X:42153028-42153050 CTGAGCTGTGAGCAGGCTTGTGG + Intergenic
1190066354 X:47244357-47244379 CTGAGGTGTGAGAGGGCTGAAGG - Intronic
1190398212 X:50006122-50006144 TTCAGTTGAGAGATGGATGGAGG + Intronic
1190752352 X:53373285-53373307 CTGGGGTGAAAGAAGGTTGGGGG - Intergenic
1192266556 X:69542624-69542646 CTGAGTTGGGAGAAATGTGGGGG + Intergenic
1195564876 X:106328868-106328890 CTGATTTGAGAAAAGGGAGGAGG + Intergenic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1195913874 X:109916432-109916454 CAGAATTGAGAGATGGATGGAGG - Intergenic
1196125583 X:112095378-112095400 CAGTGTTGAGAGCAGGTTGGTGG + Intergenic
1196891605 X:120296078-120296100 TTGAGTTGAGAGAAATTTGGAGG + Intronic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197550828 X:127890509-127890531 CTGAGCTAAAAGAAAGCTGGAGG - Intergenic