ID: 997181047

View in Genome Browser
Species Human (GRCh38)
Location 5:131829553-131829575
Sequence AGAGAGGCAATATAGGCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997181042_997181047 24 Left 997181042 5:131829506-131829528 CCTTAGTAAATTGAAATTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 211
Right 997181047 5:131829553-131829575 AGAGAGGCAATATAGGCAATCGG 0: 1
1: 0
2: 1
3: 16
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997181047 Original CRISPR AGAGAGGCAATATAGGCAAT CGG Intronic
903426263 1:23256663-23256685 AGAGAGGCAATATGGGACAATGG + Intergenic
904647685 1:31980268-31980290 AGAGAGAGAATATAGGCTTTGGG - Intergenic
905138235 1:35818095-35818117 AGAGATGGAAGATAGGAAATGGG + Intronic
906093241 1:43200653-43200675 AGAGAGGCATTCTAGGCAGAAGG + Intronic
907584165 1:55601348-55601370 AAAGAGGCATTATCTGCAATGGG - Intergenic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
910211861 1:84801680-84801702 TGAGAGACAGCATAGGCAATCGG + Intergenic
910417084 1:87012778-87012800 ACAGTGGCAGTATAGGCATTGGG + Intronic
911491571 1:98575556-98575578 AGAAAGGCAATAGAGGGAAGGGG + Intergenic
912326087 1:108764057-108764079 AGAGAGGAACAATAGGCACTAGG - Intronic
913434275 1:118830990-118831012 TGAGAGGGAATATAGGCCCTGGG + Intergenic
914409567 1:147413295-147413317 AGAGAGGCAAAATTGACACTAGG - Intergenic
914789594 1:150865773-150865795 AGATACGAAATATAGGAAATAGG - Intronic
914803755 1:150977773-150977795 AGAGAGGTAAAATAGCCAAGAGG + Intergenic
915012980 1:152707086-152707108 AGAGAGGAAATATAGGCTGGGGG + Intergenic
915379841 1:155430418-155430440 ATAGATTCAATTTAGGCAATAGG + Intronic
915573991 1:156763018-156763040 AGAGATGCACCATAGGTAATTGG - Intronic
916573007 1:166043257-166043279 AGAGAGGCCACGTAGTCAATGGG + Intergenic
917190680 1:172415413-172415435 AGGGAGGAAAGAAAGGCAATAGG - Intronic
918132017 1:181637854-181637876 GGAAAGGCATTATAGGCAGTGGG + Intronic
918535045 1:185564713-185564735 AGAGAGGCAATATACCCCGTAGG - Intergenic
919327684 1:196129718-196129740 AGAGAGGCAATATAGTGTAGTGG + Intergenic
919591489 1:199509512-199509534 AGAGAGACAAAATAACCAATAGG + Intergenic
921552111 1:216549889-216549911 AGAGAGGAAATATAGAAGATTGG + Intronic
921980521 1:221252315-221252337 AAAGTGACAATATAGGCAGTGGG + Intergenic
922208601 1:223469986-223470008 AGAGAGGAAAGACAGGCAGTTGG - Intergenic
923843131 1:237696353-237696375 AAAGATGCAGTATAGACAATGGG - Intronic
923971637 1:239209116-239209138 TGAAAGGTCATATAGGCAATTGG + Intergenic
924844582 1:247752786-247752808 ATACAGGAAATATAGGAAATAGG - Intergenic
1063496887 10:6518199-6518221 AGAAAAGAAATATATGCAATTGG + Intronic
1066482245 10:35808337-35808359 AGAGAGACAATATATGAAAAGGG - Intergenic
1067043711 10:42972200-42972222 AGAGAGGAAATATTGGGAGTAGG - Intergenic
1068419644 10:56773422-56773444 AGCCAGGCAATGTAGGCCATGGG - Intergenic
1068543971 10:58326422-58326444 GGAGAGGCAAAATTGGCAATTGG + Intergenic
1068678505 10:59793421-59793443 AGATAAGCAATAGAGGGAATTGG - Intronic
1068719237 10:60224137-60224159 AGAAAGGCAACATATGCAGTTGG + Intronic
1071198845 10:83194187-83194209 AGAGAAGCATTCTAGGCAAAGGG + Intergenic
1071436040 10:85648905-85648927 AGACAGGCAAGGTAGGCAATTGG - Intronic
1071919046 10:90328944-90328966 AGAAAGGAAATATAGGAAAGGGG + Intergenic
1071938201 10:90554639-90554661 AGAGAGTCAATATATGAAAGAGG + Intergenic
1072303160 10:94081826-94081848 CAAGAGGCAGTATAGGCAGTTGG - Intronic
1072519808 10:96221475-96221497 AGAGAGCCAATATAAGAAAGAGG - Intronic
1072568572 10:96639060-96639082 AGAAAGGCAATTTAGGCAGAAGG + Intronic
1079968571 11:27008044-27008066 GGAGAGGCCAAACAGGCAATGGG - Intergenic
1080429546 11:32185622-32185644 AGGGAGGCAATTAAGGAAATTGG - Intergenic
1081157318 11:39710289-39710311 AAAGATGCAATCTAGGCTATGGG + Intergenic
1089957897 11:122589388-122589410 AGAGAGGAAAAAAAGGCAATGGG + Intergenic
1090693341 11:129209316-129209338 AGAGAGGCAAGAGAGGAAAGGGG + Intronic
1090695698 11:129239210-129239232 AGAAAGACTATATAGGAAATAGG - Intronic
1092107324 12:5931034-5931056 AGAGAAGCAAGATAAGCAGTAGG - Intronic
1093687830 12:22076887-22076909 AGAGAGCAAAGAAAGGCAATAGG + Intronic
1094044553 12:26153103-26153125 AGAGTGGTGATATGGGCAATGGG - Intronic
1094214357 12:27924706-27924728 AGAGAGGCAAGATAGGCCTCTGG + Intergenic
1095088094 12:38080028-38080050 AGAGAGACAATCTAGTCATTAGG - Intergenic
1095702399 12:45203653-45203675 AGAGAGGCAATATAGCAAAGTGG + Intergenic
1096462163 12:51827988-51828010 AGAGAGCCCTTATAGGCAAGTGG - Intergenic
1099936141 12:89128264-89128286 AGACAAGCATTGTAGGCAATGGG - Intergenic
1106643898 13:31612861-31612883 AGAGATTCATTATAGGGAATTGG + Intergenic
1106710019 13:32320689-32320711 ACAAAGGGAATATAGGTAATGGG + Intronic
1106754025 13:32803264-32803286 AGAGAGGCAACCTAGGGAATGGG + Intergenic
1107172673 13:37361598-37361620 AGAGATACAATATAAGCAAAAGG + Intergenic
1108716675 13:53086101-53086123 AGAGAGGCAAAATAGAGAAGAGG + Intergenic
1108806491 13:54162822-54162844 AGAGAGACAATATAGTAGATGGG + Intergenic
1111602041 13:90487073-90487095 AGAGAGGCAAGGTAAGGAATTGG + Intergenic
1112720513 13:102238951-102238973 AGATAGGCAACATAGGTCATAGG - Intronic
1115111119 14:29823903-29823925 GGAGAGCCAAAATACGCAATGGG - Intronic
1115747685 14:36454343-36454365 AAAGATGCAGTATAGGAAATAGG + Intergenic
1116169995 14:41388379-41388401 AGAGGGGCAAAATATGTAATTGG - Intergenic
1118464761 14:66020930-66020952 AGAGAGAGAATATAGAAAATGGG + Intergenic
1118870822 14:69739858-69739880 AGAGTGGCACTTTAGGCAAATGG + Intronic
1119105640 14:71920912-71920934 AAAGAGGCAACATATGGAATGGG + Intergenic
1120441764 14:84550032-84550054 AGAGAGGTCAAATAGGCAGTTGG - Intergenic
1121102581 14:91260213-91260235 AGAGAGGCAGTGTAGCCAAGAGG + Intergenic
1121238484 14:92411105-92411127 AGAGAGGGAGTACAGGCATTTGG + Intronic
1202926393 14_KI270724v1_random:29866-29888 ATAAAGGCATTATAGGAAATGGG - Intergenic
1125618542 15:41037980-41038002 AGAGGGGCAAGAGAGGCATTTGG - Intronic
1126188659 15:45855809-45855831 AGAGAGGCAACCTAGTGAATGGG + Intergenic
1127225853 15:56928057-56928079 AGAGAGACAATATAGTGTATTGG + Intronic
1127764159 15:62168425-62168447 AGAGAGGCACTGTAGGGAAGGGG - Intergenic
1129075861 15:72995475-72995497 AGAGAGAAAATATTGACAATTGG - Intergenic
1130823897 15:87523958-87523980 AAAGAAGCAACATAGGCAAGAGG - Intergenic
1137997610 16:53236202-53236224 AAACAGGCAATATAGGAGATGGG - Intronic
1138126573 16:54443676-54443698 TGAGATGCAATATAGACAAGGGG + Intergenic
1138784431 16:59829512-59829534 AGAGAGGCTATACAGACAAATGG + Intergenic
1139020621 16:62744660-62744682 AGAGGGACATTCTAGGCAATGGG - Intergenic
1140758671 16:78091698-78091720 AGAGTGGCAACATGGCCAATGGG - Intergenic
1146555341 17:33818342-33818364 AGTGAGGTAATATATGCAAAAGG - Intronic
1148295823 17:46501806-46501828 AGAAATGGAATATAGACAATAGG - Intergenic
1150879617 17:69009156-69009178 GAAGAGGAAATAGAGGCAATAGG + Intronic
1155456358 18:26019038-26019060 AGAAAGGGAATATAGACAAAAGG + Intronic
1155536531 18:26824408-26824430 AGATATGCATTATAAGCAATGGG + Intergenic
1157681311 18:49609368-49609390 ATTGAGGCAATATTGGCACTTGG - Intergenic
1157887358 18:51381863-51381885 AGAGAGGTAATATAGTGAATAGG - Intergenic
1158770570 18:60512403-60512425 AGAGAGGCAGTATAGAAAAGTGG - Intergenic
1160137706 18:76286677-76286699 AGAGAGGAAATTTAGGAAACTGG + Intergenic
1163189612 19:15666975-15666997 ACAGAGGCAATATATTCACTGGG - Intergenic
1165238831 19:34446926-34446948 AGTGAGGAAATAAATGCAATAGG - Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
926412655 2:12620537-12620559 AGAGAGGCAATATAGAAATTGGG - Intergenic
927409934 2:22813674-22813696 AGAGATGCATTATAAGGAATTGG + Intergenic
929291862 2:40201797-40201819 ACAGAGGTAATAAAGTCAATGGG + Intronic
931873275 2:66484364-66484386 AGATAGTCAAAATAGGAAATGGG - Intronic
932863178 2:75315813-75315835 AGAGAGGCCATATGGAAAATGGG + Intergenic
937353502 2:121183925-121183947 GGAGAGGCAATATAAGCCTTTGG + Intergenic
938110142 2:128558876-128558898 AGAGAGGAATCATGGGCAATGGG - Intergenic
942134363 2:172910421-172910443 AGAGACTAAATATATGCAATTGG - Intronic
943183975 2:184581517-184581539 AGAGAGGCAATTGAGACAAAAGG - Intergenic
943385381 2:187197901-187197923 AGAGAGGAAATAAGGACAATAGG + Intergenic
943910624 2:193561797-193561819 AGAGTTGCAGTAAAGGCAATAGG - Intergenic
944048046 2:195436682-195436704 AGAGAGGCAATATAGCGTAGTGG - Intergenic
944117718 2:196207221-196207243 AGGCAGGGAATATAGGAAATGGG + Intronic
944321691 2:198352230-198352252 AGTGAGGGTTTATAGGCAATTGG - Intronic
944441330 2:199746555-199746577 TGAGAGGCATTAAAAGCAATAGG + Intergenic
945099180 2:206248718-206248740 ATAGAGGGAAGATAGGGAATTGG + Intergenic
945286634 2:208088992-208089014 AGAGAGCCAACAGAGGAAATAGG + Intergenic
945389011 2:209241585-209241607 AGAGAACCAATATAGGCATTAGG + Intergenic
945617106 2:212085532-212085554 AGAGTGGCAAAATAGACATTTGG + Intronic
947310828 2:228799926-228799948 GGAGAAGCAATCTAGGCAAAGGG + Intergenic
1169912942 20:10662075-10662097 AAAGAGGCCAAATAGGCAAGTGG + Intronic
1171031945 20:21684816-21684838 GGAGAGGCAAAGAAGGCAATTGG - Intergenic
1175474012 20:59256468-59256490 AGAGAGGCAGTGTAGGCAAATGG + Exonic
1181424071 22:22821723-22821745 AGAGTTGCATCATAGGCAATGGG + Intronic
1182177229 22:28303107-28303129 AGAGAGACAATATACACAAAAGG + Intronic
950255785 3:11504440-11504462 AGAGATGGAATATAGGGAATGGG + Intronic
951616119 3:24546550-24546572 AGAGAAGCAATCAAGGCAAAGGG + Intergenic
956930191 3:74034811-74034833 AAAGAAGAAATATAGGGAATGGG - Intergenic
960970276 3:123134609-123134631 AGAGAGGGAAGAAAGACAATGGG - Intronic
962047924 3:131780637-131780659 AGAGAGGAAAAATAGACACTGGG + Intronic
963559581 3:146846576-146846598 ATAGAGACAATATGAGCAATAGG - Intergenic
963644450 3:147896185-147896207 AGAGGGGCAAGATTGGCAAGGGG - Intergenic
964828093 3:160851752-160851774 AGAGAGGCAAGCCAGGAAATGGG + Intronic
965115701 3:164484869-164484891 TGAGAGGCCATATAGGAAACAGG - Intergenic
966003543 3:174980050-174980072 AGAGAGGCATTGTAGGCTGTGGG - Intronic
966479363 3:180388709-180388731 GGAAAGGCATTCTAGGCAATGGG - Intergenic
969710576 4:8840820-8840842 AGGGAGGCAAGGTAGGCAAGTGG + Intergenic
970425943 4:15946512-15946534 TGAGAGGCATTACAGGCATTTGG - Intergenic
970817516 4:20175294-20175316 CTAGAGGCAATGTAGGCAACTGG + Intergenic
971622767 4:28876907-28876929 CAAGTGGCAATATAGTCAATTGG + Intergenic
971697747 4:29928766-29928788 AGGGAGTCATTAGAGGCAATTGG + Intergenic
972752255 4:42002448-42002470 AGATAGCAAAAATAGGCAATGGG - Intronic
973850325 4:54955376-54955398 ATGGAGGAAATTTAGGCAATAGG - Intergenic
974351177 4:60748904-60748926 AGAGAGAGATTATAGGGAATTGG + Intergenic
974397317 4:61354294-61354316 AGAGAAGCAATATAGTTTATTGG - Intronic
974964393 4:68742655-68742677 AGAAAGGAATAATAGGCAATGGG + Intergenic
976981358 4:91234956-91234978 TGAGAGGCAATATAGCCTAGAGG + Intronic
977076810 4:92463793-92463815 ACACAAGAAATATAGGCAATTGG - Intronic
977245592 4:94627079-94627101 AGAGATGAAATATACGCAACTGG - Intronic
977557512 4:98500152-98500174 AGGGAGGCAATAGAGGAAAATGG - Intronic
977640519 4:99353388-99353410 TGAGAGGCAGTATAGGGAAGCGG + Intergenic
977645347 4:99405599-99405621 AGAGAAGCAATCAAGGCAGTTGG + Intergenic
981820632 4:148882683-148882705 AGTGAGGTAAAATATGCAATTGG - Intergenic
982883809 4:160752344-160752366 AGAAAGGCAATCTAGCGAATGGG - Intergenic
983469885 4:168143104-168143126 AGAAAAGAAATCTAGGCAATTGG - Intronic
984866566 4:184285484-184285506 AGAGTGGAATGATAGGCAATAGG + Intergenic
985929784 5:3047801-3047823 TGAGAGGCAATATAACCACTTGG - Intergenic
986168972 5:5300219-5300241 AGAGAGCAAATATAAGAAATGGG + Intronic
988355858 5:30173196-30173218 ATAAGGGGAATATAGGCAATAGG + Intergenic
989226149 5:39031528-39031550 AGAGAGGCAATATAAGCACAGGG - Intronic
989484308 5:41970829-41970851 AGACAGGAAATATAGGATATGGG + Intergenic
990841541 5:60085251-60085273 AGGGAGGGAATATAGGGAATAGG + Intronic
991327074 5:65445791-65445813 AGAGGAGGAATATGGGCAATGGG + Intronic
991769931 5:70030837-70030859 AGAAAGGCAAAATAGGCCAGTGG - Intronic
991849226 5:70906256-70906278 AGAAAGGCAAAATAGGCCAGTGG - Intronic
992269604 5:75052292-75052314 AGAGAGGCGATATTGGCCTTGGG - Intergenic
993172114 5:84431874-84431896 AGCCAGGCAATCTAGGCCATGGG - Intergenic
993809622 5:92459167-92459189 AGAGTGTAAACATAGGCAATTGG - Intergenic
994744627 5:103663547-103663569 CGATAGGCAATATAGGTATTTGG - Intergenic
996578548 5:125003655-125003677 ATAGAGGCTATATAAGCAATAGG + Intergenic
996951425 5:129130842-129130864 AGAAAGGCAAAATAGACAAATGG - Intergenic
997181047 5:131829553-131829575 AGAGAGGCAATATAGGCAATCGG + Intronic
997375004 5:133391525-133391547 AGAAGGGCAATATAGCCAAGTGG + Intronic
998180229 5:139932471-139932493 AGAGTGGCAAGGTAGGAAATTGG + Intronic
998799616 5:145856206-145856228 AGAGAGGAAATATAGGGAATTGG + Intergenic
999626549 5:153526947-153526969 AGTGAGCCAATATAGGGAAGAGG + Intronic
999700469 5:154223421-154223443 AGAGAGGCAATTTAGCCCAAAGG - Intronic
1000186061 5:158859294-158859316 AGAAAGGCATTACAGGCAAAAGG - Intronic
1003037787 6:2660127-2660149 AGACAGGCACTATAGGTAAAGGG + Intergenic
1003752069 6:9070041-9070063 AGAGAGAAAATAAAGGAAATGGG - Intergenic
1003860629 6:10319239-10319261 AGAGAGGTAAGATGGGGAATGGG + Intergenic
1004576264 6:16898131-16898153 AGAAATGCATTATAGGGAATTGG - Intergenic
1005413974 6:25582076-25582098 AGAGAGACAGTAGAGACAATTGG - Intronic
1007024052 6:38551682-38551704 ACAGAGGCAATATAGTGTATTGG - Intronic
1009512068 6:64565095-64565117 AAAGAGACAATCTAGGGAATGGG - Intronic
1009593365 6:65703156-65703178 AGAGAGGCACTTTAAGGAATTGG - Intronic
1011792345 6:90912179-90912201 AGATAAGCAATATAGGCAGAGGG - Intergenic
1015192048 6:130482379-130482401 AGAGAGGAATAATAGGCACTGGG + Intergenic
1015335910 6:132037952-132037974 AGAAAGGCAATTAAGGCAAGAGG + Intergenic
1016411480 6:143787837-143787859 AGAGAGGAAATATATGAAAATGG + Intronic
1017388697 6:153914338-153914360 AGAGAGGCAAGAGAGGCAAGGGG + Intergenic
1020430888 7:8115013-8115035 AGTGAGGGGATAGAGGCAATGGG + Intronic
1021126865 7:16860824-16860846 AGAGAGGAAAAATAGACAATAGG - Intronic
1022706125 7:32803572-32803594 AGAGAGGGAACATGAGCAATGGG + Intergenic
1024032941 7:45480349-45480371 AGAGATTTATTATAGGCAATTGG + Intergenic
1024159527 7:46660044-46660066 AGAGAGGTAATATGGGAATTGGG + Intergenic
1024498219 7:50071421-50071443 TGAAAGGCAATCTAGGCCATAGG + Intronic
1026471588 7:70697568-70697590 AAAAAGGAAATATAGGAAATGGG - Intronic
1027512453 7:79099649-79099671 AGAGGGGAAAAATAGACAATGGG - Intronic
1028087952 7:86659512-86659534 AGAGAAGCAATATATTCAACTGG - Intronic
1029964732 7:104727606-104727628 AGACAGGCAATATTGCAAATCGG + Intronic
1030805804 7:113917177-113917199 AAATAGGAAATATAGGAAATAGG - Intronic
1031005431 7:116465257-116465279 AGAGAGGGAAGATAGGTGATTGG - Intronic
1033771603 7:144558623-144558645 AGATATGTAAAATAGGCAATTGG - Intronic
1035517168 8:244577-244599 AAAGATGCTATATAGGCATTAGG - Intronic
1035612986 8:980747-980769 AGAGATGCAGGATAGGGAATGGG + Intergenic
1036495162 8:9263608-9263630 ACAGAGGCATTCTTGGCAATGGG + Intergenic
1039456693 8:37711977-37711999 TGAGAGGCATTACAAGCAATTGG - Intergenic
1042724104 8:71853601-71853623 AGAGATGCAATTTAGGAACTTGG + Intronic
1043549414 8:81353018-81353040 AGAGAGACAACCTATGCAATGGG - Intergenic
1043560282 8:81485167-81485189 AGAGTGGCATAATAGACAATTGG - Intergenic
1043583854 8:81744761-81744783 AGAGAGACAAAATATGAAATGGG - Intronic
1046125996 8:109909495-109909517 AGATAGACAATGTAGGTAATAGG - Intergenic
1047145240 8:122191339-122191361 AGACAGGCAACAAATGCAATGGG + Intergenic
1048561049 8:135537974-135537996 AGAAAGGGACTATTGGCAATAGG + Intronic
1048603802 8:135946836-135946858 AGAGAAGCAAGATAGGGAAGGGG + Intergenic
1048807477 8:138254105-138254127 AGAGAGACAATATATGTAATAGG - Intronic
1050122288 9:2319982-2320004 TGAGAGGCAATGTAGGCTAGTGG - Intergenic
1050360342 9:4824666-4824688 AGAGAGCCAAGATAGGGAAAAGG - Intronic
1050397846 9:5218455-5218477 AAACAGGCAACATAGGCACTGGG + Intergenic
1051100640 9:13517056-13517078 AGAGATGTCATATAGGCAGTTGG + Intergenic
1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG + Intronic
1054950559 9:70846336-70846358 AGAAAGTCAACATAGGCCATGGG - Intronic
1054998473 9:71421180-71421202 AGATAGGAAAAATAGGCACTGGG + Intronic
1055998851 9:82193152-82193174 AGAAAGGCAAGATGGGTAATAGG - Intergenic
1056240597 9:84642640-84642662 AGAGAGGGAATATATTGAATAGG - Intergenic
1056785070 9:89586118-89586140 AGATGGGAAAAATAGGCAATGGG + Intergenic
1060675519 9:125510907-125510929 CGAGAGGCAATATAGCCAGGTGG + Intronic
1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG + Intronic
1189737375 X:44085744-44085766 AGAGAGAGATTATAGGGAATTGG + Intergenic
1189944753 X:46166786-46166808 AGAGAAGCATTCTAGGTAATGGG - Intergenic
1189967491 X:46389807-46389829 ATAGAGTGAATATAGGCAGTTGG - Intergenic
1190411288 X:50139544-50139566 ACAGAAGCAATGAAGGCAATGGG + Intergenic
1191247670 X:58240773-58240795 AGAGACACAATAGAGGCAACTGG + Intergenic
1192585366 X:72314616-72314638 AGAGAGGCAATAGGGGCCAGTGG - Intergenic
1193085028 X:77441317-77441339 AGAGAGGCAAAAAAGGGAAGAGG + Intergenic
1193183138 X:78482376-78482398 AGAGAGAGAATATAGGTAGTGGG - Intergenic
1193657151 X:84212063-84212085 AGAGAGGCATTATTTGCAAAAGG - Intergenic
1194843811 X:98777648-98777670 AGTAAGGCAATATAGGATATGGG - Intergenic
1195136108 X:101908813-101908835 TGAAAGGCAGTCTAGGCAATAGG + Intronic
1195499129 X:105573663-105573685 AGAGGGGGAATATAGGAAAGGGG + Intronic
1196482842 X:116169900-116169922 AGAGAGGCAATATAGCACACTGG - Intergenic
1196597512 X:117562171-117562193 AAAGATGCAATCTAGGCTATGGG + Intergenic
1197758179 X:130010633-130010655 AGAGAAGCAAAAAAGGCAAGGGG - Intronic
1198891880 X:141405555-141405577 AGTGAGGTAAGATAAGCAATAGG - Intergenic
1199428493 X:147731568-147731590 AGAGAGGAAATAAAGACAGTGGG + Intergenic
1200273626 X:154711718-154711740 AGAGAGGCAAAGAAGGGAATGGG + Intronic
1200309898 X:155067519-155067541 AGGGAGGCATTTTAGGCAAGTGG - Intronic