ID: 997181814

View in Genome Browser
Species Human (GRCh38)
Location 5:131837036-131837058
Sequence TGATTTTTACACATGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997181811_997181814 -4 Left 997181811 5:131837017-131837039 CCTTCAATCCATCTCGAGTTGAT 0: 1
1: 5
2: 67
3: 296
4: 580
Right 997181814 5:131837036-131837058 TGATTTTTACACATGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997181814 Original CRISPR TGATTTTTACACATGGTGTA AGG Intronic
No off target data available for this crispr