ID: 997181814 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:131837036-131837058 |
| Sequence | TGATTTTTACACATGGTGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 997181811_997181814 | -4 | Left | 997181811 | 5:131837017-131837039 | CCTTCAATCCATCTCGAGTTGAT | 0: 1 1: 5 2: 67 3: 296 4: 580 |
||
| Right | 997181814 | 5:131837036-131837058 | TGATTTTTACACATGGTGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 997181814 | Original CRISPR | TGATTTTTACACATGGTGTA AGG | Intronic | ||
| No off target data available for this crispr | |||||