ID: 997183466

View in Genome Browser
Species Human (GRCh38)
Location 5:131857756-131857778
Sequence CTTTGCTGGCCCGCAAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997183457_997183466 26 Left 997183457 5:131857707-131857729 CCTCCACCTCACTTTGCTGTCAT 0: 1
1: 0
2: 3
3: 33
4: 323
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data
997183458_997183466 23 Left 997183458 5:131857710-131857732 CCACCTCACTTTGCTGTCATGCA 0: 1
1: 0
2: 0
3: 13
4: 212
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data
997183461_997183466 -4 Left 997183461 5:131857737-131857759 CCCAAGGTCCTCTCCACTGCTTT 0: 1
1: 0
2: 0
3: 26
4: 198
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data
997183459_997183466 20 Left 997183459 5:131857713-131857735 CCTCACTTTGCTGTCATGCACTC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data
997183462_997183466 -5 Left 997183462 5:131857738-131857760 CCAAGGTCCTCTCCACTGCTTTG 0: 1
1: 0
2: 2
3: 27
4: 271
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data
997183456_997183466 30 Left 997183456 5:131857703-131857725 CCTTCCTCCACCTCACTTTGCTG 0: 1
1: 0
2: 2
3: 53
4: 542
Right 997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997183466 Original CRISPR CTTTGCTGGCCCGCAAGCGC AGG Intronic
No off target data available for this crispr