ID: 997191934

View in Genome Browser
Species Human (GRCh38)
Location 5:131945610-131945632
Sequence TTGCTGTGAGGCTGCTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997191934_997191937 10 Left 997191934 5:131945610-131945632 CCCGCGGAGCAGCCTCACAGCAA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 997191937 5:131945643-131945665 GAAAGCAAAAGCCCCAGAACTGG 0: 1
1: 0
2: 3
3: 38
4: 297
997191934_997191939 20 Left 997191934 5:131945610-131945632 CCCGCGGAGCAGCCTCACAGCAA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 997191939 5:131945653-131945675 GCCCCAGAACTGGAGCCGCCGGG 0: 1
1: 0
2: 2
3: 27
4: 191
997191934_997191938 19 Left 997191934 5:131945610-131945632 CCCGCGGAGCAGCCTCACAGCAA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 997191938 5:131945652-131945674 AGCCCCAGAACTGGAGCCGCCGG 0: 1
1: 0
2: 0
3: 30
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997191934 Original CRISPR TTGCTGTGAGGCTGCTCCGC GGG (reversed) Intronic