ID: 997191934 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:131945610-131945632 |
Sequence | TTGCTGTGAGGCTGCTCCGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 129 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 119} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997191934_997191937 | 10 | Left | 997191934 | 5:131945610-131945632 | CCCGCGGAGCAGCCTCACAGCAA | 0: 1 1: 0 2: 1 3: 8 4: 119 |
||
Right | 997191937 | 5:131945643-131945665 | GAAAGCAAAAGCCCCAGAACTGG | 0: 1 1: 0 2: 3 3: 38 4: 297 |
||||
997191934_997191939 | 20 | Left | 997191934 | 5:131945610-131945632 | CCCGCGGAGCAGCCTCACAGCAA | 0: 1 1: 0 2: 1 3: 8 4: 119 |
||
Right | 997191939 | 5:131945653-131945675 | GCCCCAGAACTGGAGCCGCCGGG | 0: 1 1: 0 2: 2 3: 27 4: 191 |
||||
997191934_997191938 | 19 | Left | 997191934 | 5:131945610-131945632 | CCCGCGGAGCAGCCTCACAGCAA | 0: 1 1: 0 2: 1 3: 8 4: 119 |
||
Right | 997191938 | 5:131945652-131945674 | AGCCCCAGAACTGGAGCCGCCGG | 0: 1 1: 0 2: 0 3: 30 4: 211 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997191934 | Original CRISPR | TTGCTGTGAGGCTGCTCCGC GGG (reversed) | Intronic | ||