ID: 997193105

View in Genome Browser
Species Human (GRCh38)
Location 5:131958283-131958305
Sequence CTGGGCCTACGTGGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997193105_997193114 15 Left 997193105 5:131958283-131958305 CCTTCAAATCCACGTAGGCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 997193114 5:131958321-131958343 GACCACTCATTTGTGGTCTCTGG No data
997193105_997193112 8 Left 997193105 5:131958283-131958305 CCTTCAAATCCACGTAGGCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 997193112 5:131958314-131958336 GGCCTACGACCACTCATTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997193105 Original CRISPR CTGGGCCTACGTGGATTTGA AGG (reversed) Intronic
904179538 1:28656262-28656284 CTGGGCCTATTTGGATTTTGGGG - Intergenic
904439817 1:30522925-30522947 CTTGGCCCACGTGGTTTTGAGGG - Intergenic
904783507 1:32968024-32968046 CTGGGTCTACCTGGAATTGGGGG - Intergenic
904974931 1:34448768-34448790 CTGGGCCAAGGAAGATTTGATGG - Intergenic
912643022 1:111365158-111365180 TTTCGCCAACGTGGATTTGATGG - Intergenic
916517758 1:165535688-165535710 CTGGGCCTGGGTAGATTTGGTGG + Intergenic
920174608 1:204092706-204092728 CTGGGCCTACTTGGATTTAGGGG + Intronic
920276788 1:204812133-204812155 TTGTGCCTTCATGGATTTGAGGG + Intergenic
1067047136 10:42991154-42991176 CTGGGCCTACGGGCAGTTGGGGG - Intergenic
1067233266 10:44426516-44426538 CTGGGGCTACCTGGACTTCAGGG + Intergenic
1074973243 10:118560117-118560139 CTGGGCCTACTTGGTTTTACAGG + Intergenic
1075948294 10:126456350-126456372 CTTGGCCAACGTGGGTTTTATGG - Intronic
1076857293 10:133123677-133123699 CTGGGCCGACGTCGAGTTGTGGG + Intronic
1084708655 11:70830467-70830489 CTGGGTCTCCGTGGCTTGGAGGG - Intronic
1085771259 11:79328203-79328225 ATGGTCCTACTTGGATGTGATGG + Intronic
1105842710 13:24268881-24268903 CTGTCCTTACCTGGATTTGAGGG + Intronic
1109957186 13:69583515-69583537 CTTGGCCTTTTTGGATTTGAAGG - Intergenic
1112066267 13:95796322-95796344 CTGGGCCGCCGTGGCTTGGAAGG + Intergenic
1128082729 15:64865926-64865948 CTGGGCCTTGATGGACTTGATGG - Exonic
1138095361 16:54207073-54207095 CTGGGCATGCCTGGATTTCAGGG + Intergenic
1138107614 16:54297664-54297686 GTGGGCCTAAAAGGATTTGAAGG - Intergenic
1141484423 16:84329454-84329476 CTGGGCCAAACTGGGTTTGATGG - Exonic
1144778661 17:17797231-17797253 CAGGGCCTCCGGGGATGTGAAGG - Exonic
1149480743 17:57001190-57001212 CTGAGCCTACCTGGGTTTGGGGG + Intronic
1149667550 17:58376163-58376185 ATGTGCCTGCGTGGATTTCAAGG + Intronic
1161689061 19:5720257-5720279 CTGGGCCTACGCGGAGAAGAGGG + Exonic
1163000169 19:14362230-14362252 CTGGGCCAAGGGGGAGTTGATGG + Intergenic
1166271609 19:41717866-41717888 CTGGGCCTGCATGGATTTGCTGG - Intronic
1167506465 19:49873469-49873491 CTGGGCCTGCGAGGACTGGATGG - Intronic
1167578167 19:50327718-50327740 CAGGGCCTAGGAGAATTTGAGGG + Intronic
925069223 2:953216-953238 CTGACCATACCTGGATTTGAGGG + Intronic
925181842 2:1822548-1822570 CTGGGACCACATGGATCTGAGGG + Intronic
929870454 2:45754765-45754787 CTGGGCTGACGTGCATTGGAAGG + Intronic
937983512 2:127628359-127628381 CTGGGCCTCCCTGGAGATGAAGG - Exonic
938062076 2:128262050-128262072 CTGGGCCCACATGGTTTTGCTGG + Intronic
945623376 2:212170553-212170575 CTTGGCCTACGTGCCTGTGATGG - Intronic
946393180 2:219428901-219428923 CTGGGCTCAGGTGGATTAGAGGG + Intergenic
947309848 2:228789465-228789487 ATGGGCCTATGTGGATCTCATGG - Intergenic
948515775 2:238503199-238503221 CTGGGCCTGCTTGGATGGGAGGG + Intergenic
948546250 2:238730776-238730798 CTGAGGCTTCGTGGAGTTGAAGG - Intergenic
1170540143 20:17379331-17379353 CTGGGCAAATGTGGATCTGATGG + Intronic
1171100827 20:22382249-22382271 CTGAGCCTCCTGGGATTTGAAGG - Intergenic
1174300097 20:49575605-49575627 CTGGGCCTTTGGAGATTTGAAGG + Intergenic
1180070226 21:45432180-45432202 CAGGGCCTCCCTGGATTTGGGGG + Intronic
1181139733 22:20795795-20795817 CTGGGCCTAGGAGGACTTTAAGG - Intronic
1183308939 22:37098858-37098880 CTGGGCCTATGTGGATTTCCTGG - Intronic
949500958 3:4679556-4679578 CAGGCCCTCCGTGGATTGGATGG + Intronic
953784875 3:45903769-45903791 CTGGGCCCACGTTGATCTGCTGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
961398583 3:126616623-126616645 CTGGGCCTGCCTGCATTTGGAGG - Intronic
963980953 3:151536257-151536279 CTTGGGCTGCGTGGATGTGAAGG + Intergenic
970815543 4:20151757-20151779 CTGGGGCTTCGTGTATTTGTGGG + Intergenic
971748925 4:30621295-30621317 CTGGAGCTAGGTGGCTTTGAGGG - Intergenic
979612327 4:122702602-122702624 CTGGGCCTGCCTGGAATAGAAGG + Intergenic
980871724 4:138619336-138619358 CTTGGCCTCCCTGGATTTCAAGG - Intergenic
983874817 4:172863384-172863406 CTCCGCCTATGTGGATTTGCAGG - Intronic
987747178 5:21990545-21990567 CTGGGCTTATTTGGATATGAAGG - Intronic
991767353 5:70000307-70000329 CTGGGCTTATTTGGATATGAAGG - Intergenic
991846589 5:70875385-70875407 CTGGGCTTATTTGGATATGAAGG - Intergenic
997193105 5:131958283-131958305 CTGGGCCTACGTGGATTTGAAGG - Intronic
1000492084 5:161926297-161926319 CTCCGCCCACGTGGATTTGCAGG - Intergenic
1002897315 6:1387065-1387087 CTGGTCCTGCCTGGATTTTAAGG + Intergenic
1005920452 6:30396760-30396782 CTGGGCACACCTGGCTTTGATGG - Intergenic
1017050897 6:150392376-150392398 CTGGACCTTCGTGGTTGTGAAGG + Exonic
1025804053 7:64812503-64812525 CTGGTTCTATTTGGATTTGATGG + Intronic
1030806774 7:113929502-113929524 CTGGGCCTCCGGGGCTGTGATGG - Intronic
1033707625 7:143904339-143904361 CTAGGCCTATGTAGTTTTGAGGG - Intergenic
1040545701 8:48396709-48396731 CTGGGCCTCCGAGTAGTTGAGGG - Intergenic
1041441386 8:57900751-57900773 CTGGGCATATGTAGATTTTAAGG - Intergenic
1042169978 8:65981671-65981693 CTGGGCTTATGTGTTTTTGATGG + Intergenic
1047619936 8:126596144-126596166 CTGGACCTACAAGTATTTGAAGG + Intergenic
1048825005 8:138415815-138415837 ATGGGCCTATGGGGATGTGAAGG - Intronic
1185671281 X:1812106-1812128 CTGAGCAGACGTGAATTTGAGGG + Intergenic