ID: 997194971

View in Genome Browser
Species Human (GRCh38)
Location 5:131973290-131973312
Sequence TCGTGGGACCACAGGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997194963_997194971 15 Left 997194963 5:131973252-131973274 CCTGCAGAACTTACCTTGTCGTA 0: 1
1: 0
2: 0
3: 6
4: 47
Right 997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 195
997194961_997194971 30 Left 997194961 5:131973237-131973259 CCTGGCTGAAGACTCCCTGCAGA 0: 1
1: 0
2: 2
3: 22
4: 223
Right 997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 195
997194962_997194971 16 Left 997194962 5:131973251-131973273 CCCTGCAGAACTTACCTTGTCGT 0: 1
1: 0
2: 1
3: 9
4: 84
Right 997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 195
997194965_997194971 2 Left 997194965 5:131973265-131973287 CCTTGTCGTACATCCGGTTCAGC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997194971 Original CRISPR TCGTGGGACCACAGGGAAGA TGG Exonic
900673688 1:3870958-3870980 GCTGCGGACCACAGGGAAGACGG + Intronic
901924201 1:12555556-12555578 TTCTGGGCCCACAGTGAAGAGGG + Intergenic
902801079 1:18830655-18830677 TCGTCGGCCCAGGGGGAAGAAGG + Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903667532 1:25017114-25017136 TCCTGGGGGCACAGGGATGAAGG + Intergenic
903886793 1:26545645-26545667 TTGTAGGCCCACAGGGAGGATGG + Intronic
904615315 1:31746377-31746399 TCTTGGGACCACAGAGGAGGTGG + Intronic
904932672 1:34102541-34102563 TGGTTGGATCACAGGGATGAGGG - Intronic
905363621 1:37436766-37436788 TCCTGGGAACACAAGGGAGAAGG + Intergenic
907117044 1:51978100-51978122 TTCTGGGAGCACAGGGAAGCTGG - Intronic
908247985 1:62243038-62243060 TAATGGGCCCACAGGTAAGATGG - Intronic
911069424 1:93820765-93820787 TCGTCTGACCTCTGGGAAGAGGG - Intronic
914247529 1:145897164-145897186 TCCTGGGACTTCAGGGAAGGGGG - Intronic
915324347 1:155073153-155073175 TTATGGGAACACAGGGAAAACGG + Intergenic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
915923889 1:160001654-160001676 TTGGGGGAACACTGGGAAGATGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
921901264 1:220453480-220453502 TGGAAGAACCACAGGGAAGAAGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
923014694 1:230117545-230117567 TCGTGGTATCGCAGGGAATAGGG + Intronic
923234396 1:232018739-232018761 TGGAGGGACAGCAGGGAAGATGG + Intronic
923408058 1:233682484-233682506 TCCTGGGACCACGCAGAAGATGG + Intergenic
924800079 1:247322962-247322984 GGCTGGGACCACAGGGAAGGAGG + Intronic
1065627033 10:27640308-27640330 TCCTGGAAGCACAGTGAAGAAGG + Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067782444 10:49218653-49218675 TCCTGGGACCACAGAGAGGAGGG - Intergenic
1068800166 10:61131704-61131726 TTGTGGGACCTCAGTGGAGAGGG - Intergenic
1068938880 10:62661623-62661645 TCCTGGGGACTCAGGGAAGAGGG + Intronic
1069533038 10:69232929-69232951 TCCTGTGACCGCAGGGAAGGCGG + Intronic
1070692699 10:78539355-78539377 GCATGGGAGAACAGGGAAGAAGG - Intergenic
1070732707 10:78842336-78842358 ACATGAGACCACAGGGATGAGGG + Intergenic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1076794930 10:132793805-132793827 TCTTTGGACCCCAGAGAAGAGGG - Intergenic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077266742 11:1654701-1654723 TCGGGGAAGCGCAGGGAAGAGGG - Intergenic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1078185836 11:9051429-9051451 TCGTGGGAGGACAGGGCTGAGGG + Intronic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1089507255 11:118972051-118972073 TCGCGGGACCCCGGGGCAGACGG + Intronic
1089581678 11:119485297-119485319 TCCTGGGAGCAGAGGCAAGACGG - Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090084610 11:123640407-123640429 TTGTGGGACCACAGGAATGGAGG + Intronic
1092094224 12:5828208-5828230 TCGGGGAACCTCAGGGAAGGCGG + Intronic
1093458086 12:19384141-19384163 TCCTAGGCCCAAAGGGAAGAGGG + Intergenic
1096594750 12:52687764-52687786 CCGTGGGACCACAGGAAGGGTGG - Intergenic
1101128700 12:101666294-101666316 TCTTGGGTCCCCAGGGAACACGG - Intronic
1102985943 12:117278376-117278398 TCATGGGCCCACAGGACAGAGGG + Intronic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112491070 13:99864455-99864477 TCGTAAAACCACAGGGGAGAAGG - Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1120475215 14:84978355-84978377 ACGTAGGACCACAGGAAGGATGG - Intergenic
1121619838 14:95338456-95338478 TCATGGAAACACAGGGCAGAGGG + Intergenic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1124613728 15:31226428-31226450 TCCTGGGTCCACTGGGAAGTTGG - Intergenic
1129542742 15:76364288-76364310 CCCTGGGACCACCGGGAAGAAGG - Intronic
1129608184 15:77034975-77034997 CCGTGGGCCCACAGGGAGGAGGG + Intronic
1130213191 15:81945140-81945162 TCGTGAGACCGCAGGGGAGGAGG - Intergenic
1131050227 15:89342918-89342940 TCTAGGGGCCACAGGCAAGAGGG + Intergenic
1131271149 15:90948372-90948394 TCTTTTGACCCCAGGGAAGAGGG + Intronic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1133180308 16:4049257-4049279 ACCTGGGACCAGAGAGAAGAGGG + Intronic
1134347588 16:13405297-13405319 ACATGGGACCACAGGGTAGGAGG + Intergenic
1137446923 16:48537565-48537587 TCATTGGACCACAGGGATAAAGG + Intergenic
1140905413 16:79405174-79405196 TCCTAGGACCCCAGGGGAGAAGG + Intergenic
1142080488 16:88146430-88146452 ACCCGGGTCCACAGGGAAGAAGG - Intergenic
1143009410 17:3857648-3857670 TTGTGGGACCACCAGGAAGCAGG + Intergenic
1144945016 17:18965401-18965423 TCGTGGGACAGCAGAGAAGCTGG - Intronic
1149066810 17:52490254-52490276 TAGTGGCAACTCAGGGAAGAGGG + Intergenic
1152640829 17:81448515-81448537 TCTGGGGCCCACAGGGAAGACGG - Intronic
1153982577 18:10322836-10322858 TCGTGGGACTATAAGGATGAAGG - Intergenic
1155071659 18:22322112-22322134 TTGTGGAATCACATGGAAGAAGG + Intergenic
1155165818 18:23231626-23231648 ACTTGGGACCACAAGAAAGACGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158547709 18:58410174-58410196 TGGTGGGAGCACAGGCGAGAAGG - Intergenic
1158875337 18:61728892-61728914 TCCTGGAACCACAGAGAAAAAGG - Intergenic
1160075046 18:75666762-75666784 TATTGGGAACACAGGGAAAATGG + Intergenic
1160098341 18:75897015-75897037 TCTCTGGACCACAGGGAAGTGGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161854282 19:6754516-6754538 TCATGGTTCCCCAGGGAAGAAGG - Intronic
1162463120 19:10824968-10824990 TGGTGGGACAATAGGGCAGATGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1164729885 19:30495601-30495623 GCGTAGGCCCACAGGGCAGAAGG + Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
925578795 2:5388646-5388668 CCATGGGACAACAGGGAAAAGGG + Intergenic
925654900 2:6136093-6136115 TCATGGGATCACTGGGAATATGG + Intergenic
926559017 2:14394814-14394836 TGGAGGGACACCAGGGAAGATGG + Intergenic
926813317 2:16775749-16775771 TCCTGGGACCTCAGGGCATAGGG - Intergenic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928195785 2:29215641-29215663 TCCTTGGATCCCAGGGAAGAGGG - Intronic
928915811 2:36469167-36469189 TCTTGGCACCACTGGGAAGAGGG - Intronic
932190947 2:69741510-69741532 TGCTGGGCGCACAGGGAAGAGGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933776480 2:85774158-85774180 TCGTGGGGCCAAAGGCAAGGAGG + Intronic
933807716 2:86012189-86012211 TGGTGGGAGCACAGGGCAGAGGG - Intergenic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
935332649 2:101988528-101988550 TCCTGGGCCCACGGGGCAGAAGG + Intergenic
936855527 2:116953245-116953267 TGGTGGGACCAGAAGGAAGGAGG + Intergenic
939560456 2:143725585-143725607 TTGTGGAACCACAGGGAAGGAGG - Intronic
940807925 2:158208600-158208622 TCATGAGACCACAGGGGAGGAGG + Intronic
945860428 2:215115257-215115279 TCGTGAGACCATAGTGTAGAGGG - Intronic
1168924484 20:1567904-1567926 TCTTGGAGCCACAGGGCAGAAGG + Intronic
1170196379 20:13693447-13693469 TCGTGGGAGCTCAGGAGAGATGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1174403349 20:50288225-50288247 TAGTGAGACCACTGGGAAAAGGG + Intergenic
1174422322 20:50407475-50407497 TAGTGGGACCACATGGAATGGGG - Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1178911148 21:36674663-36674685 CCATGGGACCACATGGAGGAAGG + Intergenic
1179598684 21:42461117-42461139 TCCTGGGACCAGAGAGATGAGGG - Intergenic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1180835597 22:18928081-18928103 TCAAGGCACCACAGGGAAGAGGG + Intronic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181630386 22:24148058-24148080 TCTTGGGACCAAAAGGAGGAGGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1181807448 22:25383639-25383661 TCCTGGAGCCACAGGGCAGAGGG + Intronic
1181966070 22:26657509-26657531 TCGCGGGACCAGAGGGAGGGAGG + Intergenic
1183434418 22:37785144-37785166 TCGGGGGACCAAAGGAGAGAGGG + Intergenic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
1185414692 22:50703685-50703707 TCCTGGGTCCAGAGGTAAGAAGG - Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1203285685 22_KI270734v1_random:153380-153402 TCAAGGCACCACAGGGAAGAGGG + Intergenic
951168224 3:19507417-19507439 GCCTGGGCTCACAGGGAAGAGGG + Intronic
952718244 3:36504171-36504193 TTGTGGGAGCACAGAGAAGGTGG + Intronic
957060959 3:75480982-75481004 TCATGGAGACACAGGGAAGAAGG + Intergenic
957351231 3:79024055-79024077 TGGTGGGACCATTGGGATGATGG - Intronic
961292423 3:125858438-125858460 TCATGGAGACACAGGGAAGAAGG - Intergenic
962978565 3:140467564-140467586 TCCTGGGGCCCCAGGGAGGAAGG - Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
966133408 3:176670628-176670650 GTGGGGGACCACAGGGAAGTGGG - Intergenic
966854152 3:184182736-184182758 TCCTGGGAACACAGGGACAATGG - Exonic
968697509 4:2040454-2040476 GCGTGGGACCGAAGGGGAGAAGG + Intronic
970052536 4:11931013-11931035 TGGTGGGACCACAAGATAGAAGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
971227466 4:24768264-24768286 TCCTGGCATCACAGGTAAGATGG + Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
976388029 4:84482725-84482747 TCCCGGGACCTCGGGGAAGAGGG + Intergenic
979618851 4:122775781-122775803 TGATGGGGCCTCAGGGAAGATGG + Intergenic
986300179 5:6472258-6472280 TCCTGTGACCACAGGGAGGTGGG - Intronic
987096199 5:14552597-14552619 ACGTGAGGACACAGGGAAGATGG + Intergenic
988404445 5:30805979-30806001 TCATGGGAACACAGAGAAGCTGG - Intergenic
989563357 5:42875908-42875930 TCCGGGGGCCACAGAGAAGAAGG + Intronic
990703610 5:58502120-58502142 ACGTGAAACCACAGGCAAGAGGG + Intergenic
993017338 5:82549853-82549875 TTGTGGGACCATAGGGATGGTGG + Intergenic
996226646 5:121007427-121007449 TGGTGGAACAACAAGGAAGATGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
999194774 5:149774480-149774502 TCGTGGGACCAGAAGCCAGAAGG - Intronic
999770627 5:154773036-154773058 TGTTGGGACAACTGGGAAGAGGG + Intronic
1000376986 5:160592010-160592032 TCGAGGGAGCTCTGGGAAGAGGG - Intronic
1000408958 5:160918021-160918043 TCATAGGACCACAGTGAGGAAGG + Intergenic
1000702751 5:164473667-164473689 TCCTATTACCACAGGGAAGAAGG - Intergenic
1001638913 5:173231761-173231783 GCTTGGGAGCACAGGGAAGGCGG + Intergenic
1002321595 5:178379432-178379454 TAGTGGGACCTCTGGGCAGAGGG + Intronic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1004035236 6:11917129-11917151 TACTGGCACCCCAGGGAAGATGG + Intergenic
1004527639 6:16424253-16424275 TCAAGGGACGAGAGGGAAGAAGG + Intronic
1005406490 6:25494230-25494252 TCATGGAATCTCAGGGAAGAGGG - Intronic
1005986474 6:30878896-30878918 TCATGGGAACCCAGGGAAGGAGG - Intronic
1006401834 6:33822300-33822322 TCTTGGGACCCCAGGCTAGAGGG + Intergenic
1006581258 6:35079063-35079085 TCCTGGCTCCCCAGGGAAGACGG - Intronic
1007680220 6:43628808-43628830 TCCCGGGACCCCAGGGAGGAAGG - Intronic
1007930657 6:45687566-45687588 TCAGGCGACCACAAGGAAGATGG - Intergenic
1017912195 6:158802937-158802959 TCCTGACACCACAGGGAAGCAGG + Intronic
1019372784 7:671732-671754 TGCTGGGGCCACAGGGAACAAGG - Intronic
1019923881 7:4179879-4179901 TCGGGGGAGCACAGGAAAGGAGG + Intronic
1022911067 7:34899972-34899994 TGGTGGGGCCACAGGGAGGAGGG + Intergenic
1025248498 7:57335976-57335998 TAGTGGGACCACATGGAATGGGG + Intergenic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1032197307 7:129796749-129796771 TCCTGGGTCATCAGGGAAGAGGG - Intergenic
1032322915 7:130900670-130900692 TCAGGGGACCACTGGGAAGAAGG + Intergenic
1032878545 7:136064222-136064244 TTCTGGGACCACAGGAAGGAGGG + Intergenic
1033781344 7:144672981-144673003 TCCTTAGACTACAGGGAAGATGG - Intronic
1035475716 7:159143119-159143141 TTGTGGCCCCACAGAGAAGAGGG + Intronic
1035519858 8:266993-267015 TGGGGGGACCACAGGGGATATGG + Intergenic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1047648157 8:126890654-126890676 TTGTGTGACCACAGGAAAGCTGG - Intergenic
1048491855 8:134901616-134901638 CCTGGGGACCACAGGAAAGATGG - Intergenic
1049009329 8:139876753-139876775 GCCTGGAACCACAGGGAAGATGG - Intronic
1049247801 8:141571973-141571995 TATTGGGACCACATGGCAGAGGG + Intergenic
1049330771 8:142049313-142049335 TCATGGGGCCACAGGGAGGATGG - Intergenic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1053533188 9:38901576-38901598 TCGTGTGAGCCCCGGGAAGAAGG + Intergenic
1054205414 9:62126005-62126027 TCGTGTGAGCCCCGGGAAGAAGG + Intergenic
1054632947 9:67462365-67462387 TCGTGTGAGCCCCGGGAAGAAGG - Intergenic
1056678508 9:88696933-88696955 TCCTTGGCCCGCAGGGAAGAGGG + Intergenic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057996163 9:99822959-99822981 TCGGAGGACCTCAGGAAAGAGGG + Intronic
1060180396 9:121529736-121529758 TCGTGGGAACTCAGGCAAGGAGG + Intergenic
1061178962 9:129012943-129012965 CCGTGGGTCCACGGGCAAGATGG + Intronic
1062166409 9:135109869-135109891 TCGTGTGACCACAGGAGGGACGG + Intronic
1062283355 9:135761823-135761845 CCGTGGGCCCACAGGGGAAAGGG - Intronic
1190106779 X:47566802-47566824 GCCGGGGACCACAGGGCAGAGGG + Intronic
1191674839 X:63783854-63783876 TAATGGGACCTCAGGGAAGTAGG + Intronic
1192444436 X:71200015-71200037 TTGTGGGAACACAGGTAAAAAGG - Intergenic
1192558700 X:72110603-72110625 TCTTGAGACCACAGGCTAGAAGG - Intergenic
1192972332 X:76246157-76246179 TCGTTGGAGCTCAGGGAAGAAGG + Intergenic
1193339858 X:80335215-80335237 TCGTGGGACCACGTCGAATATGG - Intergenic
1194641327 X:96406944-96406966 ATGGGGGACCACAGGGTAGAGGG - Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic