ID: 997202246

View in Genome Browser
Species Human (GRCh38)
Location 5:132018011-132018033
Sequence AGCTACCCTGAAAGTCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997202246_997202253 17 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202253 5:132018051-132018073 ACAGTACAGAGGGAGAGAAGAGG No data
997202246_997202251 7 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202251 5:132018041-132018063 GCCTGGGAAGACAGTACAGAGGG No data
997202246_997202248 -9 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202248 5:132018025-132018047 AGGGTAGCTCCTTTAAGCCTGGG No data
997202246_997202254 18 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG No data
997202246_997202255 30 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202255 5:132018064-132018086 AGAGAAGAGGGAAGAGTCAGAGG No data
997202246_997202247 -10 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202247 5:132018024-132018046 CAGGGTAGCTCCTTTAAGCCTGG No data
997202246_997202250 6 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202250 5:132018040-132018062 AGCCTGGGAAGACAGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997202246 Original CRISPR AGCTACCCTGAAAGTCCTCA TGG (reversed) Intergenic
No off target data available for this crispr