ID: 997202249

View in Genome Browser
Species Human (GRCh38)
Location 5:132018034-132018056
Sequence TACTGTCTTCCCAGGCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997202249_997202253 -6 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202253 5:132018051-132018073 ACAGTACAGAGGGAGAGAAGAGG No data
997202249_997202255 7 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202255 5:132018064-132018086 AGAGAAGAGGGAAGAGTCAGAGG No data
997202249_997202258 23 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202258 5:132018080-132018102 TCAGAGGCTTTTAGAGGTGGTGG No data
997202249_997202254 -5 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG No data
997202249_997202256 17 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202256 5:132018074-132018096 GAAGAGTCAGAGGCTTTTAGAGG No data
997202249_997202259 27 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202259 5:132018084-132018106 AGGCTTTTAGAGGTGGTGGAAGG No data
997202249_997202257 20 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202257 5:132018077-132018099 GAGTCAGAGGCTTTTAGAGGTGG No data
997202249_997202260 30 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202260 5:132018087-132018109 CTTTTAGAGGTGGTGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997202249 Original CRISPR TACTGTCTTCCCAGGCTTAA AGG (reversed) Intergenic
No off target data available for this crispr