ID: 997202254

View in Genome Browser
Species Human (GRCh38)
Location 5:132018052-132018074
Sequence CAGTACAGAGGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997202249_997202254 -5 Left 997202249 5:132018034-132018056 CCTTTAAGCCTGGGAAGACAGTA No data
Right 997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG No data
997202246_997202254 18 Left 997202246 5:132018011-132018033 CCATGAGGACTTTCAGGGTAGCT No data
Right 997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997202254 Original CRISPR CAGTACAGAGGGAGAGAAGA GGG Intergenic
No off target data available for this crispr