ID: 997202599

View in Genome Browser
Species Human (GRCh38)
Location 5:132020818-132020840
Sequence ACCCTTGAGGAGCATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997202599_997202607 8 Left 997202599 5:132020818-132020840 CCATCACCATGCTCCTCAAGGGT No data
Right 997202607 5:132020849-132020871 CCTGCCCAAGCATAAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997202599 Original CRISPR ACCCTTGAGGAGCATGGTGA TGG (reversed) Intergenic
No off target data available for this crispr