ID: 997203340

View in Genome Browser
Species Human (GRCh38)
Location 5:132026190-132026212
Sequence CTGCCAACAAGGAGTTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997203340_997203350 25 Left 997203340 5:132026190-132026212 CCTTGGTAACTCCTTGTTGGCAG No data
Right 997203350 5:132026238-132026260 CTAGGTCCTAGCATTGCATTTGG No data
997203340_997203347 7 Left 997203340 5:132026190-132026212 CCTTGGTAACTCCTTGTTGGCAG No data
Right 997203347 5:132026220-132026242 CCTGTTCCTTACTATGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997203340 Original CRISPR CTGCCAACAAGGAGTTACCA AGG (reversed) Intergenic
No off target data available for this crispr