ID: 997205041

View in Genome Browser
Species Human (GRCh38)
Location 5:132043279-132043301
Sequence TGTTAGCCAGAGAACACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997205035_997205041 15 Left 997205035 5:132043241-132043263 CCCTCTGGGGGCTCTGTCCCAGG No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205032_997205041 20 Left 997205032 5:132043236-132043258 CCCCTCCCTCTGGGGGCTCTGTC No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205037_997205041 14 Left 997205037 5:132043242-132043264 CCTCTGGGGGCTCTGTCCCAGGA No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205031_997205041 24 Left 997205031 5:132043232-132043254 CCTGCCCCTCCCTCTGGGGGCTC No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205033_997205041 19 Left 997205033 5:132043237-132043259 CCCTCCCTCTGGGGGCTCTGTCC No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205034_997205041 18 Left 997205034 5:132043238-132043260 CCTCCCTCTGGGGGCTCTGTCCC No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205038_997205041 -2 Left 997205038 5:132043258-132043280 CCCAGGAAGTTTTCAAATCTCTG No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data
997205039_997205041 -3 Left 997205039 5:132043259-132043281 CCAGGAAGTTTTCAAATCTCTGT No data
Right 997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997205041 Original CRISPR TGTTAGCCAGAGAACACTGG TGG Intergenic
No off target data available for this crispr