ID: 997205995

View in Genome Browser
Species Human (GRCh38)
Location 5:132050499-132050521
Sequence GAGATAGGGGGCCCTACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997205983_997205995 7 Left 997205983 5:132050469-132050491 CCACAATTCCTGAGCCAGGTATC No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205979_997205995 15 Left 997205979 5:132050461-132050483 CCCTGCGCCCACAATTCCTGAGC No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205980_997205995 14 Left 997205980 5:132050462-132050484 CCTGCGCCCACAATTCCTGAGCC No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205982_997205995 8 Left 997205982 5:132050468-132050490 CCCACAATTCCTGAGCCAGGTAT No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205978_997205995 16 Left 997205978 5:132050460-132050482 CCCCTGCGCCCACAATTCCTGAG No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205985_997205995 -1 Left 997205985 5:132050477-132050499 CCTGAGCCAGGTATCCAGGCCTG No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data
997205986_997205995 -7 Left 997205986 5:132050483-132050505 CCAGGTATCCAGGCCTGAGATAG No data
Right 997205995 5:132050499-132050521 GAGATAGGGGGCCCTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997205995 Original CRISPR GAGATAGGGGGCCCTACCTG GGG Intergenic