ID: 997206771

View in Genome Browser
Species Human (GRCh38)
Location 5:132054778-132054800
Sequence AGGAAGAAGGATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997206763_997206771 8 Left 997206763 5:132054747-132054769 CCATTGTGGGTAGGGGCTTTTGG No data
Right 997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997206771 Original CRISPR AGGAAGAAGGATGAGGAGGA GGG Intergenic
No off target data available for this crispr