ID: 997207175

View in Genome Browser
Species Human (GRCh38)
Location 5:132056780-132056802
Sequence GGCTCACGGAAGCGCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997207168_997207175 -1 Left 997207168 5:132056758-132056780 CCAGGCTATGCCTCGGTCCAAGG No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207165_997207175 9 Left 997207165 5:132056748-132056770 CCAGGATGACCCAGGCTATGCCT No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207160_997207175 24 Left 997207160 5:132056733-132056755 CCTTGAAGGAGACCCCCAGGATG No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207167_997207175 0 Left 997207167 5:132056757-132056779 CCCAGGCTATGCCTCGGTCCAAG No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207162_997207175 12 Left 997207162 5:132056745-132056767 CCCCCAGGATGACCCAGGCTATG No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207163_997207175 11 Left 997207163 5:132056746-132056768 CCCCAGGATGACCCAGGCTATGC No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data
997207164_997207175 10 Left 997207164 5:132056747-132056769 CCCAGGATGACCCAGGCTATGCC No data
Right 997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997207175 Original CRISPR GGCTCACGGAAGCGCTGTGG TGG Intergenic
No off target data available for this crispr