ID: 997223151

View in Genome Browser
Species Human (GRCh38)
Location 5:132187066-132187088
Sequence CAGTAGGCACCGTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997223151_997223155 -6 Left 997223151 5:132187066-132187088 CCCAGCTCCAACGGTGCCTACTG No data
Right 997223155 5:132187083-132187105 CTACTGTAGTGCCAACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997223151 Original CRISPR CAGTAGGCACCGTTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr