ID: 997223993

View in Genome Browser
Species Human (GRCh38)
Location 5:132195159-132195181
Sequence CTGGGAAATGTCTCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997223993_997224000 10 Left 997223993 5:132195159-132195181 CCAGCAACAGAGACATTTCCCAG 0: 1
1: 0
2: 0
3: 24
4: 204
Right 997224000 5:132195192-132195214 CCTTTCTGAGGTAGAAGTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208
997223993_997224001 30 Left 997223993 5:132195159-132195181 CCAGCAACAGAGACATTTCCCAG 0: 1
1: 0
2: 0
3: 24
4: 204
Right 997224001 5:132195212-132195234 GGGAACTCACCCGCCCCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 89
997223993_997223998 9 Left 997223993 5:132195159-132195181 CCAGCAACAGAGACATTTCCCAG 0: 1
1: 0
2: 0
3: 24
4: 204
Right 997223998 5:132195191-132195213 ACCTTTCTGAGGTAGAAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 170
997223993_997223996 -2 Left 997223993 5:132195159-132195181 CCAGCAACAGAGACATTTCCCAG 0: 1
1: 0
2: 0
3: 24
4: 204
Right 997223996 5:132195180-132195202 AGAAAGCACCTACCTTTCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997223993 Original CRISPR CTGGGAAATGTCTCTGTTGC TGG (reversed) Intronic
901971787 1:12914122-12914144 CTGGGAAATGTCTCGGTGCAGGG - Intronic
902013381 1:13287618-13287640 CTGGGAAATGTCTCGGTGCAGGG + Intergenic
902399002 1:16147354-16147376 TTGGGAAATGCTTCTGTTGAGGG - Intronic
902883972 1:19391867-19391889 CTTGGAGATGCCTCTGTGGCTGG - Intronic
908510607 1:64847532-64847554 CAGGGAAATATCCCTGTGGCTGG + Exonic
909365078 1:74811546-74811568 CTTGGAAACGTCACTGTTACTGG - Intergenic
910061935 1:83104359-83104381 CTGGGAAAAGTCTTTCTTGAAGG - Intergenic
912173975 1:107135643-107135665 CTGGGAACTGTCCTTGGTGCTGG - Intergenic
912373392 1:109191023-109191045 CTGGGAGATGGCCATGTTGCTGG + Intronic
915140194 1:153763168-153763190 GAGGGGACTGTCTCTGTTGCTGG + Intronic
916432496 1:164744626-164744648 CTGGGCAATGACTCTGTGCCAGG - Intronic
917700596 1:177576614-177576636 CTGGGAAATGACACTGGGGCAGG + Intergenic
918182016 1:182092208-182092230 CTGGGAAATGTCACCCTTGCTGG + Intergenic
918799410 1:188953433-188953455 CTGGGACATGTCTGTCCTGCAGG + Intergenic
918833778 1:189432933-189432955 CTCTGAAATGTCTTTGTTCCAGG + Intergenic
921725580 1:218519940-218519962 CTGGGAAATGTTTCTCATGTTGG - Intergenic
922348955 1:224720425-224720447 CTGGGAAACGTGGCTGTAGCAGG + Intronic
923041120 1:230320478-230320500 CTGAGGGATGTCTCTGCTGCAGG - Intergenic
923736034 1:236608671-236608693 CTTGAAAATATATCTGTTGCTGG + Intergenic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1064421718 10:15196460-15196482 CTGGGAAATGGCTCTGTTCTAGG + Intergenic
1064513365 10:16119629-16119651 CAGGGAGCTGTCTCTGGTGCTGG - Intergenic
1064718464 10:18202622-18202644 CTGAGAAATTACTCTGTTCCAGG - Intronic
1065664392 10:28042301-28042323 TAGGGAGATGTCTCTGTTGCTGG - Intergenic
1067380942 10:45772815-45772837 CTGGGAAATGACCCTGTGCCTGG - Intronic
1067888640 10:50113454-50113476 CTGGGAAATGACCCTGTGCCTGG - Intronic
1069573146 10:69506678-69506700 CTGGGAGAAGTCTCTGCTGTGGG + Intronic
1070986919 10:80697099-80697121 CTGGGCACCGTCTCTGTTCCTGG + Intergenic
1072817057 10:98519751-98519773 CAAGAAAATGTCTCTGTGGCTGG - Intronic
1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG + Intergenic
1075683610 10:124349255-124349277 CTGGGAAATCTCTCTTTCGAGGG + Intergenic
1078720597 11:13880298-13880320 CTGGGAAATCTCTCACTGGCCGG + Intergenic
1080493367 11:32792075-32792097 ATGGTAAATGTCTTTGTTGATGG - Intronic
1081788978 11:45769400-45769422 CTGAGAAAAGTCTGTGTGGCAGG - Intergenic
1084567444 11:69939494-69939516 CTGGGAAATGTGTGTGTTGAGGG - Intergenic
1085682841 11:78594430-78594452 CTGAGAAATGTCTTTGTGGGGGG - Intergenic
1085776216 11:79369151-79369173 CTGGGAACTGTCCCTGCAGCTGG + Intronic
1086229487 11:84550992-84551014 CTGTGAATTGTCTCTGGTGGTGG + Intronic
1087023807 11:93629803-93629825 CTGAGAACTGTCTCTCTTTCGGG + Intergenic
1088723811 11:112617387-112617409 CTGGGAATTGTATCTCTAGCAGG + Intergenic
1090109205 11:123886710-123886732 CTGGGAAAAGGCTCTGAGGCAGG + Intergenic
1090146801 11:124333215-124333237 CTGGGAAATGTATGTTTTGGAGG + Intergenic
1090170429 11:124597747-124597769 CTGGAGTCTGTCTCTGTTGCTGG - Intergenic
1091059086 11:132444989-132445011 CTGGTCAATGTCTCACTTGCTGG + Intronic
1091831602 12:3554266-3554288 CTGGGAAATGTCGCTGTCCATGG - Intronic
1092289287 12:7149569-7149591 CTGTGAAATTTCTCTGGTGGGGG + Exonic
1095743666 12:45633879-45633901 CTGGGAAATCTCTCAGTCTCAGG + Intergenic
1095915743 12:47475805-47475827 CTGGAGAAGGTCTCTGTTTCTGG - Intergenic
1100654004 12:96620837-96620859 CTGGGAAATGGCTCAGCTGTGGG + Intronic
1101942877 12:109113202-109113224 CTGGGAAATGTCTTCTTTCCTGG - Intergenic
1103440913 12:120962362-120962384 CTGGGAAATGTCTTCATTCCAGG - Intergenic
1106775843 13:33008753-33008775 CTGGGAAATCTGACTGTTCCTGG - Intergenic
1107286775 13:38802325-38802347 CAGGTAATTGTCACTGTTGCCGG - Intronic
1108485709 13:50922056-50922078 CTTGGAAAAGTCTCATTTGCAGG + Intronic
1108495974 13:51025793-51025815 ATGGCAAATGTCCCTGATGCTGG - Intergenic
1110006997 13:70285172-70285194 TTGGGAAATTTCTCTTTTGTAGG + Intergenic
1110084353 13:71358711-71358733 CTGGGAAATGTATTTCTTGGAGG + Intergenic
1110339199 13:74369240-74369262 CTGGGGAATGTATTTCTTGCTGG + Intergenic
1111597193 13:90427529-90427551 CTGGGCCATGCCTCTGATGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113739457 13:112701189-112701211 CTGGGATGGGTCGCTGTTGCAGG - Intronic
1117497387 14:56319006-56319028 CTAGATAATGTCTCTGCTGCTGG + Intergenic
1119742390 14:77022636-77022658 CTGGGAGTTGTCCCTGTTACCGG - Intergenic
1120831846 14:89004434-89004456 CTGGGAAATGAGTCTTTTGCTGG - Intergenic
1121109375 14:91302284-91302306 CTGGGAAATGGCCCTGCTGATGG - Intronic
1122244026 14:100388654-100388676 CTGGGAAATGTCTCATTTGTTGG - Intronic
1122547534 14:102532390-102532412 CTGGGAAATGTCTTAATTCCAGG + Intergenic
1122683782 14:103488145-103488167 GTTAGAACTGTCTCTGTTGCAGG + Intronic
1124161023 15:27270228-27270250 TCTAGAAATGTCTCTGTTGCAGG + Intronic
1124709307 15:31992343-31992365 CTGGGAAATATCTCAGTTTCAGG + Intergenic
1125219582 15:37317798-37317820 CTGGGAGATGTCTCTGAGTCAGG - Intergenic
1126311548 15:47322775-47322797 TTGGGAAATATCACAGTTGCTGG - Intronic
1127604449 15:60572287-60572309 CTGAGAAATGTGTATGTTGGGGG + Intronic
1127725419 15:61744772-61744794 CTGGGAAATGCTCCTGTTGCTGG - Intergenic
1130222179 15:82028908-82028930 CTTGGAAATGGCACTGTTCCTGG + Intergenic
1130302256 15:82689031-82689053 CTGAGAAATGTCTCTGAGCCAGG - Intronic
1130907897 15:88252909-88252931 CTGGGAACTGCCTCTGATGGGGG - Intronic
1131155507 15:90072936-90072958 CTGGGAAATGTCTCTTTTTGAGG - Intronic
1135509983 16:23074147-23074169 CAGGGAACTGTGTCTGTGGCGGG + Intronic
1138213713 16:55184558-55184580 CTGGGAGATGTCTCCATTGCTGG - Intergenic
1138507198 16:57484340-57484362 ATGGGAAATGGCTCTGGTGCTGG - Intronic
1140521987 16:75589599-75589621 CAGGGAAATGTCTCTGTGGGAGG - Intergenic
1140651755 16:77095740-77095762 CTGGCTATTGTCTCTCTTGCTGG - Intergenic
1143067151 17:4259103-4259125 CTAGGATATTTCTCAGTTGCAGG - Intronic
1143611413 17:8019972-8019994 CTTGGAGATGGCTCTGTAGCTGG + Intronic
1144038856 17:11390809-11390831 ATGTAACATGTCTCTGTTGCTGG - Intronic
1144127673 17:12218041-12218063 GTGGGAAATGGCTCTGTTTGAGG + Intergenic
1145993491 17:29092867-29092889 CTGGGCAATCTCTCGCTTGCTGG + Exonic
1146527267 17:33577709-33577731 CTGGGACATCTCTCAGTTGGTGG - Intronic
1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG + Intronic
1148988856 17:51647901-51647923 CTGGGCAATGTCTCTCTAGGTGG + Intronic
1153166599 18:2268710-2268732 CTGGGATATTATTCTGTTGCAGG - Intergenic
1153894155 18:9543782-9543804 CTGGGACATGTTTCTGTGGAGGG - Intergenic
1156696500 18:39774098-39774120 CTGGGAAATGTCCCTGTGCCAGG - Intergenic
1159011049 18:63058695-63058717 CTGGGAATGGTCACTGGTGCAGG - Intergenic
1159391736 18:67802340-67802362 CTTGAAAAGGTCTCTGTTGTGGG + Intergenic
1160982522 19:1822904-1822926 CTGGGAAAGGTCTGTGTGTCTGG - Intronic
1161059681 19:2208650-2208672 CTGGGATGTGTCTCTGCTTCTGG - Intronic
1163251025 19:16126387-16126409 TTGTGAAAGGTCTCTGTTTCTGG + Intronic
1163819512 19:19487934-19487956 GTGGGAAATGGTTCTGTGGCTGG + Intronic
1164294677 19:23899392-23899414 TTTTGAAATGTCTCTGTGGCTGG + Intergenic
1164650373 19:29886960-29886982 CAAGGAAATGTATCTGTAGCTGG - Intergenic
1168706421 19:58472833-58472855 CTGTGAGATGGCTCTGTGGCTGG + Exonic
925493110 2:4417922-4417944 ATGGAAACTTTCTCTGTTGCTGG - Intergenic
926166923 2:10526895-10526917 TTGGGAAATGGCTCGGTTTCTGG + Intergenic
927234755 2:20860972-20860994 CTTCCAAGTGTCTCTGTTGCTGG - Intergenic
928411785 2:31060031-31060053 CTGTGAAATGTATCTAGTGCAGG - Intronic
929969043 2:46557734-46557756 GTGGGAAATGTCTTTTCTGCAGG - Intronic
932700523 2:73988119-73988141 CTGGGAGACTTCTCTGTTGCTGG + Intronic
935868906 2:107423638-107423660 CTGGGAAATGCCTTCTTTGCTGG + Intergenic
936016510 2:108963158-108963180 CTGGAATGTGTCTCTGTTGTTGG - Intronic
937822557 2:126327279-126327301 CTGGGTGATGTCAATGTTGCAGG + Intergenic
938623915 2:133087854-133087876 CTGAGCAATTACTCTGTTGCAGG + Intronic
938773872 2:134524077-134524099 CTGGGTTATGTCGCTGCTGCTGG - Intronic
938797265 2:134728382-134728404 CTGGGAACTGCCTCAGTGGCCGG - Intergenic
939094221 2:137815046-137815068 CTGGGACATGGCTCTTCTGCTGG - Intergenic
940913295 2:159227999-159228021 CTGGAGAAGGGCTCTGTTGCTGG - Intronic
941049768 2:160719437-160719459 CTTGGAAAATTCTCTTTTGCAGG + Intergenic
942468478 2:176233773-176233795 CTGGGAAATGTCTTTATTCCAGG + Intergenic
943095710 2:183426793-183426815 CTGGGGAGTGTATCTGTTGAAGG + Intergenic
945633265 2:212311776-212311798 CTGGGAAATGTCATTGCTTCTGG - Intronic
946436873 2:219662887-219662909 CTGGGACAGGTCTCTACTGCTGG + Intergenic
948312712 2:237000679-237000701 CTGGCAAATGACTCAGTTCCTGG + Intergenic
948567965 2:238898423-238898445 CTGGGGAATGGTGCTGTTGCTGG + Intronic
1169385637 20:5147085-5147107 CTGGGAAATGTCCCTCCTGAGGG + Intronic
1170681488 20:18529752-18529774 CTGGAAAATGTCATTGTTCCAGG + Intronic
1172046490 20:32084254-32084276 CTTGGGAATGTCTCTGATGGTGG + Intronic
1174551127 20:51362473-51362495 CTGGGAAATGTGGCTATTCCAGG + Intergenic
1174787192 20:53444051-53444073 CTGGGAAATGCCTCAGTCCCGGG - Intronic
1175583117 20:60116039-60116061 GTTGGACATGTCTCTGTTGTGGG + Intergenic
1176311825 21:5154679-5154701 CCGGGAAGTGTCTCTGTGGGCGG - Exonic
1179845224 21:44107356-44107378 CCGGGAAGTGTCTCTGTGGGCGG + Exonic
1183342941 22:37292056-37292078 CTGGGAAATGAGCCTGTAGCAGG - Intronic
1184411308 22:44327946-44327968 CTGGGAAAAGCCTCTCTTGGGGG + Intergenic
1184463162 22:44651699-44651721 CTGGGAAATGTGTAGCTTGCAGG - Intergenic
1184813059 22:46850272-46850294 CTGTGAAATGTCTCATTTCCTGG + Intronic
950174914 3:10866330-10866352 CTGGGAAATGTCTTTATTTGGGG + Intronic
951091005 3:18573822-18573844 ATGGGAGGTGTCTCTGGTGCTGG - Intergenic
951466418 3:23004754-23004776 CTGGGATATGGCTATGTTCCTGG - Intergenic
953785469 3:45907852-45907874 CTGGGCACTGTACCTGTTGCTGG - Intronic
954794584 3:53155040-53155062 CTGGGAACTGGCTGTGTTTCCGG + Intergenic
954834950 3:53458130-53458152 CTGGGATATGTTTCTTTTGAGGG + Intergenic
955043904 3:55341934-55341956 CTGGAGAATGTCACTGTTGCTGG - Intergenic
955353068 3:58208306-58208328 CTGGGAATTCTCTTTCTTGCAGG - Exonic
955663629 3:61327524-61327546 CTGAGAAATGACTATGTAGCTGG - Intergenic
956328985 3:68084175-68084197 CTGGGAAATTTCCCTGATGGAGG + Intronic
956482958 3:69691171-69691193 CTGGGGAATGTTTCTGATTCTGG + Intergenic
959631684 3:108514197-108514219 CTGGGAAATACCTCAGTTCCGGG - Intronic
960446942 3:117760759-117760781 CTGGGAAACGTGTCATTTGCAGG + Intergenic
962574228 3:136741100-136741122 CTGGGACATGTCTTTCTTCCAGG - Intronic
963288703 3:143464675-143464697 CCAGGAAATGCCTCTGTTGCTGG - Intronic
964403243 3:156321100-156321122 CTGGGAAAAGTTTCTCTTACTGG - Intronic
965543188 3:169890624-169890646 TGGGGAAATGTCGTTGTTGCTGG + Intergenic
965670484 3:171142730-171142752 ATTGGAAATGTCTCTGTTTTGGG - Intronic
967300177 3:188004865-188004887 CAGGGCAATGTCTCTGATGTTGG + Intergenic
969300255 4:6293255-6293277 CTGGGCCCTGTCGCTGTTGCTGG + Intronic
970877589 4:20890155-20890177 CTAGGAACTGTCTCAGATGCTGG + Intronic
971932260 4:33099779-33099801 CTTGGAAATGTATCTGTGGCTGG + Intergenic
972954735 4:44375480-44375502 CTGTGAGATGTCTCTGTTCCTGG + Intronic
973589629 4:52427670-52427692 CTGGGAAATGTCTTTATTCTGGG + Intergenic
977075249 4:92442714-92442736 CTGTAAAGTGTCTCGGTTGCTGG + Intronic
980678191 4:136118209-136118231 CTGGGAAATTCCTCAGTCGCAGG - Intergenic
981240817 4:142474155-142474177 CTGGGAAACATCTGTGTAGCTGG + Intronic
982351880 4:154424872-154424894 ATGGGAAGGGTCTCTGTAGCTGG - Intronic
983099980 4:163613362-163613384 CTGGGAGCTGTCCCTGTTGTTGG + Exonic
984874520 4:184355374-184355396 CTGGGTAAAGTCATTGTTGCTGG + Intergenic
985019322 4:185670790-185670812 CTGGCAGCTGTGTCTGTTGCCGG + Intronic
987139899 5:14934459-14934481 CAGGGAAATGTCTCTATTTCTGG + Intergenic
987713332 5:21533042-21533064 GTTGGAAAGGTTTCTGTTGCAGG - Intergenic
990430516 5:55730556-55730578 CTGGGAAATCTCTTTGTGCCCGG + Intronic
990651398 5:57903987-57904009 CTGGAAAATATTTCTGTTGTAGG + Intergenic
990666388 5:58077229-58077251 CTTGGAATTATCTCTGTTCCAGG - Intergenic
991054331 5:62305891-62305913 CCGGGAATTGGCGCTGTTGCCGG - Intergenic
992116231 5:73540838-73540860 GTGGTGAATGTCTCTGATGCTGG + Intergenic
993142237 5:84049772-84049794 CTGAGAAATGCCTCTGTTTAGGG + Intronic
993441256 5:87959614-87959636 CTGGGAGATGACTCCTTTGCTGG - Intergenic
995509693 5:112896027-112896049 CTGGGAAATATCTCTTCTGGGGG - Intronic
997223993 5:132195159-132195181 CTGGGAAATGTCTCTGTTGCTGG - Intronic
997461361 5:134054783-134054805 CTGGGAAGTGCCTCAGTTACTGG + Intergenic
998186454 5:139983312-139983334 ATGAGAAAGGTCTCTGTTTCTGG + Intronic
1001465703 5:171963764-171963786 ATGGGATATTTCTTTGTTGCTGG - Intronic
1001525673 5:172426871-172426893 CTGGGAAATGTCCCGGATTCAGG - Intronic
1004295649 6:14407434-14407456 CTGGAAAATGGCTTTGTGGCTGG - Intergenic
1005868900 6:29958515-29958537 CTGGGTACTGTCCCTGTTTCGGG - Intergenic
1006746368 6:36345697-36345719 CTGGAAACTGTCACTGTGGCAGG - Intergenic
1007046721 6:38783107-38783129 CTGTGAAATCTCTCTGATCCAGG - Exonic
1008421516 6:51305900-51305922 CTGGGAAATGTAACTGTTTAGGG + Intergenic
1008909992 6:56721590-56721612 CTGTGATAATTCTCTGTTGCCGG - Intronic
1009003385 6:57748846-57748868 GTTGGAAAGGTTTCTGTTGCAGG + Intergenic
1009420681 6:63461042-63461064 ATCGTAAATGTCTCTGCTGCTGG + Intergenic
1011428519 6:87257744-87257766 ATGGGAAATTTATCTGTAGCAGG + Exonic
1012083005 6:94784882-94784904 CTGGGAAATGTCTCCCTCTCAGG + Intergenic
1012855899 6:104501357-104501379 TTGGGAAATCTCCCTGCTGCAGG - Intergenic
1013166329 6:107596021-107596043 CTGGCAAAAGTCTCAGTTCCTGG - Intronic
1016103082 6:140127742-140127764 CTGGGAAATGTCTCTCCCTCAGG - Intergenic
1017038527 6:150288718-150288740 CTGGGACTTGACTCTGTTGGTGG + Intergenic
1019696560 7:2449589-2449611 CTGGGAAGTGTGACTGCTGCCGG - Intergenic
1019956335 7:4417625-4417647 ATGGAAAATCTCTCTCTTGCTGG + Intergenic
1022538707 7:31115179-31115201 CTTGGAACTGTCTGTGGTGCTGG - Intergenic
1023465903 7:40454400-40454422 CTGAGAAATGTGTCAGTTGGTGG + Intronic
1023658924 7:42453775-42453797 GTGTGAAATGTCTGTGTTGAGGG - Intergenic
1028603720 7:92631260-92631282 CTGGGAAACCTCTCTGTCCCAGG + Intronic
1029998036 7:105028802-105028824 CTAGGAAATGTCTCAGTCTCAGG - Intronic
1032266343 7:130372700-130372722 CTGGGAAATAGCTCTATAGCTGG + Intergenic
1032682142 7:134195894-134195916 CTGGGCAATGTGTCTGCTGCAGG - Intronic
1033276538 7:139975900-139975922 CTGGGTGACGTCTCTGTTTCAGG - Intronic
1033607525 7:142938291-142938313 ATGGCCTATGTCTCTGTTGCTGG + Intergenic
1033791791 7:144799021-144799043 TTGGTAAATGTCTCTCTTGAAGG - Intronic
1036608203 8:10326819-10326841 CTGGGAAATGTTTCTCATGATGG - Intronic
1036761733 8:11514159-11514181 CTGGGCAAGGTCTCTGTCCCTGG + Intronic
1036806912 8:11841378-11841400 CTGGGAAATGGCTCAGTAGATGG - Intergenic
1043549035 8:81348196-81348218 TTGGAAAATGTCTCTTTTCCTGG - Intergenic
1043674464 8:82933860-82933882 CTGGGTCATTTCTCTGTTGTGGG - Intergenic
1044266387 8:90186829-90186851 CTGGGAAATGTCCTTGCTCCTGG + Intergenic
1045586553 8:103544356-103544378 CTGGGAAATAACTGTGTAGCAGG + Intronic
1045697019 8:104820806-104820828 CTGGGACATTTCTCTCTTCCAGG - Intronic
1049627635 8:143632987-143633009 CTGGGAAATGTCCCTGAGGAAGG - Intergenic
1050095696 9:2063228-2063250 CTGGTACCTGTCTCTTTTGCGGG + Intronic
1053314450 9:37039584-37039606 TTGGGAAGTGTCTCTGGTGATGG - Intergenic
1055293033 9:74803868-74803890 CTGAGGAGTGTCTCTGGTGCTGG + Exonic
1056801867 9:89697849-89697871 CTGAGAAATGTTTCTGTTGTGGG + Intergenic
1059980427 9:119765718-119765740 CTGGTAATTGTCTCTCATGCTGG + Intergenic
1061356179 9:130106867-130106889 CAGGGAAGTCTCTCTGTTGGTGG + Intronic
1186020369 X:5247581-5247603 ATGTGAAATGTGTTTGTTGCAGG - Intergenic
1186032775 X:5388162-5388184 ATGGTAAATGTTTCTGTTCCCGG - Intergenic
1186044380 X:5519256-5519278 CTGGGATCTGTCTCTGCTTCCGG + Intergenic
1188400016 X:29732720-29732742 TTGGAGAATGTCTCTGTTGCTGG + Intronic
1192299697 X:69886778-69886800 CTGGGTAATGTGGCTGCTGCTGG - Intronic
1199386616 X:147230561-147230583 CTGGGAAAAGTCTCTCATGTAGG - Intergenic