ID: 997225877

View in Genome Browser
Species Human (GRCh38)
Location 5:132209076-132209098
Sequence CCTGGACTCTGGCTCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997225877_997225882 -10 Left 997225877 5:132209076-132209098 CCTGCCCAGAGCCAGAGTCCAGG 0: 1
1: 0
2: 4
3: 59
4: 450
Right 997225882 5:132209089-132209111 AGAGTCCAGGTCCACAGCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997225877 Original CRISPR CCTGGACTCTGGCTCTGGGC AGG (reversed) Intronic
900158930 1:1214249-1214271 CGGGGACCCTGGCTGTGGGCTGG + Intergenic
900564314 1:3324877-3324899 CAGGGACTCTGGCCCAGGGCAGG - Intronic
900687853 1:3959975-3959997 CCTGGATTCTAGCACAGGGCTGG + Intergenic
901175130 1:7293348-7293370 CCTGGACACTGTTTCAGGGCTGG + Intronic
901289991 1:8116596-8116618 CCAGGTGTCTGGCGCTGGGCAGG + Intergenic
901680918 1:10912386-10912408 CCTGGCCACTGGCACGGGGCAGG + Intergenic
901747745 1:11385724-11385746 CCAGGACTTTGGGTCTGGACTGG - Intergenic
901770780 1:11529428-11529450 TCTGGACTCGGGCTCTGCCCCGG - Intronic
901808996 1:11755224-11755246 CCTGGAGCCTGGCTTTGGGCTGG + Intergenic
902378060 1:16039531-16039553 CCTAGACCCTGGCTGTGGGAAGG - Intergenic
902383149 1:16062027-16062049 CCTAGACCCTGGCTGTGGGAAGG - Intronic
902802780 1:18840592-18840614 CCTGGAGCCTGGCCCTGTGCAGG - Intronic
902818083 1:18927384-18927406 CCTGGCCTCTGGCAGAGGGCAGG + Intronic
903193672 1:21669854-21669876 CTTGGACTTTGTCTCTGGACTGG + Intergenic
903220390 1:21865933-21865955 CCTGGCCTCTTGGTTTGGGCAGG - Intronic
903330572 1:22595082-22595104 CCTGCGCCCTGACTCTGGGCTGG + Intronic
903889362 1:26559137-26559159 CCCAGACCCTGGCTCTGTGCTGG - Intronic
904028217 1:27518288-27518310 ACTGGACTCTGGCCAAGGGCAGG + Intergenic
904824219 1:33264179-33264201 GCTGGACCCTGGCTCTGGCCCGG - Intronic
905878218 1:41447091-41447113 CCTTGACTCCTTCTCTGGGCTGG + Intergenic
905891807 1:41522621-41522643 CCAGGGCCCTGGCTCTGTGCTGG + Intronic
905902118 1:41588597-41588619 GCTGGACACTGACCCTGGGCAGG - Intronic
906163915 1:43671674-43671696 CCTGGGCTCTGGCTCTTCACGGG + Exonic
906686297 1:47765533-47765555 TGTGGACTGTGGCTCTGGACTGG - Exonic
907048921 1:51316681-51316703 CCTGGCCCCTCGCTCTTGGCAGG + Intronic
907089397 1:51710198-51710220 TCTGGACTCTAGGTCTGAGCTGG - Intronic
907304243 1:53505014-53505036 GCTGCCCTCTGGCTCCGGGCTGG - Intergenic
907488647 1:54794768-54794790 CCTGGGCTATGGGGCTGGGCCGG - Intronic
908351236 1:63287347-63287369 CCTGGATTCTGGGTCTGTGGGGG - Intergenic
908419508 1:63946150-63946172 GCTGGTGTGTGGCTCTGGGCAGG + Intronic
912943991 1:114069502-114069524 ACTGGACGCTGGCTCTGAGTTGG - Intergenic
914865814 1:151427897-151427919 CCAGGACTCTGGCCCAGGGAAGG + Exonic
916123653 1:161550575-161550597 CCGGGCCACTGGATCTGGGCTGG + Intronic
916133538 1:161631930-161631952 CCGGGCCACTGGATCTGGGCTGG + Intronic
917478226 1:175387041-175387063 CCTGGCCCCTGGCACTGTGCAGG + Intronic
918315412 1:183318663-183318685 CGTGGCCTCTGGCTCAAGGCAGG - Intronic
918372472 1:183874910-183874932 CCTTGACCCTGACTCTGGGCCGG - Intronic
918746611 1:188209392-188209414 GCTGGAATATAGCTCTGGGCTGG + Intergenic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
919895951 1:202010073-202010095 CCAGGACTCTGGCCAGGGGCTGG - Exonic
920069319 1:203290844-203290866 CCTGGGCTCTGGCTCTTGAGAGG - Intergenic
920351732 1:205342472-205342494 CCTGGAGCCTGGCACTGTGCTGG + Intronic
920502926 1:206496815-206496837 CCAGGACTGTGAGTCTGGGCAGG + Exonic
921841763 1:219836159-219836181 TCTGACCTCTGGCTCTGGGCAGG - Intronic
923306766 1:232695778-232695800 CCTGGGCTATAGCTTTGGGCTGG + Intergenic
923307000 1:232697451-232697473 CCTGGAAGCTGGCTCTCGGGGGG + Intergenic
924502788 1:244652955-244652977 CCTGCGCTCTGGTTCTCGGCCGG - Exonic
924787298 1:247210522-247210544 CCTGGCCTCAGGATGTGGGCTGG - Intergenic
1062801657 10:385568-385590 CTCGGATTCTGGCTCTGGCCGGG + Intronic
1062955376 10:1536636-1536658 CTAGGACTCTGGCTCTAGACAGG + Intronic
1064176611 10:13080825-13080847 TCTGGCCTCTGGCCTTGGGCTGG - Intronic
1065286903 10:24195114-24195136 CCTTGACTCTCTCTCTGGGCTGG + Intronic
1066188336 10:33032041-33032063 CCTGGCCTCTGGTGCTGGCCTGG - Intergenic
1067082094 10:43217685-43217707 CCAGGACTCTGACTCTGCCCAGG + Intronic
1069639098 10:69943612-69943634 CCTGGCCTCAGTCTCTGGCCGGG - Intronic
1069797532 10:71062894-71062916 CCCGGACTCTGGCACTGCCCAGG - Intergenic
1069897185 10:71687136-71687158 CCCAAACTCTGGCCCTGGGCTGG - Intronic
1070540172 10:77410024-77410046 ACTGTCCTCTGGTTCTGGGCAGG + Intronic
1070716259 10:78724241-78724263 CCTGGCGTCTGCTTCTGGGCAGG + Intergenic
1070771135 10:79082899-79082921 CCAGCACTCTGGCCCTGGGGAGG + Intronic
1070812783 10:79306660-79306682 CCTGGACTCTGTCCCTAGGAGGG - Intronic
1071598387 10:86943952-86943974 CCTGGACTCTGGAGATGGCCTGG + Exonic
1073978181 10:109124036-109124058 CCTGGCCTCTGACTCAGGGTAGG - Intergenic
1075399686 10:122151946-122151968 GCTGGACTGTGACTCTGGGCAGG + Intronic
1075686876 10:124370588-124370610 CATGGACTCTGCCACTGGCCAGG + Intergenic
1075711617 10:124533818-124533840 CTTGGGGTCTGGCCCTGGGCTGG - Intronic
1076258114 10:129044886-129044908 CCTGGACCCTGGTTCTGAGCAGG - Intergenic
1076549348 10:131267849-131267871 CCTCGACTCTGGCACGGGCCTGG - Intronic
1076573570 10:131449116-131449138 CCTGGACTTTGGCTGTTTGCTGG + Intergenic
1076634431 10:131873168-131873190 CCTGGACGCTGGCTTTGGAAGGG + Intergenic
1076738150 10:132467878-132467900 CCAGGACTCTGCCTGGGGGCAGG + Intergenic
1076763484 10:132617227-132617249 CCTGGGCTCTGGCTCTTTGCAGG + Intronic
1076835470 10:133018768-133018790 TCTGGACTCTGGCTCTGGCGGGG - Intergenic
1076863866 10:133157933-133157955 CCTGAACTGTGGCTCCTGGCTGG - Intergenic
1077107766 11:849472-849494 CCCGGACTCTGGCCCCGGGCCGG - Intronic
1077487485 11:2845750-2845772 CCTGGGCTCCTGCTCTGGGCAGG + Intronic
1077529247 11:3087562-3087584 CCTGGACGCTCGCTCTGGTGGGG - Exonic
1077632623 11:3821361-3821383 GCTGGGCTCTGGCACTGCGCTGG + Intronic
1078415788 11:11163499-11163521 CCTGGACTCTTGATCTGGGAGGG + Intergenic
1078908505 11:15709600-15709622 CCTAGACTCTGGCTCTCTGTAGG - Intergenic
1079007106 11:16799835-16799857 CCTCGCCTGTGGCTCAGGGCTGG - Intronic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1081729658 11:45361399-45361421 CCTTGCCTCTGGATCTGGTCTGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083428487 11:62601715-62601737 GCTGGAGCCTGGCTCTGGCCTGG - Exonic
1083966949 11:66049019-66049041 CCTGGGCTCTGCCTCTGGCCCGG + Exonic
1084213777 11:67635815-67635837 TCTGGAGGCAGGCTCTGGGCGGG - Intronic
1084266984 11:68010243-68010265 GCCTGACTCTGGCTCTGGGCGGG - Intronic
1084325947 11:68400103-68400125 GCAAGACGCTGGCTCTGGGCCGG - Intronic
1084411555 11:69008994-69009016 CCTGGGCTCTGCCTTTGCGCTGG + Intronic
1084453292 11:69252515-69252537 CCTCGGCTCTGGCTCGGGGAGGG + Intergenic
1084710073 11:70838721-70838743 CCTGGACTCTCACTCTGCACAGG + Intronic
1085088323 11:73688294-73688316 GCTGAACTCTGGATCTAGGCTGG + Intronic
1085326547 11:75610834-75610856 CCAGGACTCTGGCTGGGGGGCGG + Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088010496 11:104995115-104995137 GCAGGACTCTGGCTCTGTGAAGG + Intronic
1089301755 11:117503149-117503171 CGTTGAGGCTGGCTCTGGGCAGG + Intronic
1089567433 11:119379086-119379108 GCTGGAGCCTGACTCTGGGCTGG + Intronic
1089695661 11:120214859-120214881 CCTTCACTCAGCCTCTGGGCAGG - Intronic
1090014285 11:123072061-123072083 CCAGAAGTCTAGCTCTGGGCTGG - Exonic
1090075663 11:123578683-123578705 CCTGGACACTGCCTCTGGCTGGG + Intronic
1090377854 11:126304016-126304038 GCTGGACTCGGGCTAGGGGCGGG + Exonic
1090838835 11:130472634-130472656 CCTAGCCTCAGGCTCTGGGATGG + Intronic
1091205938 11:133821144-133821166 CCAGGACCTTGGCCCTGGGCAGG + Intergenic
1091368016 11:135038070-135038092 CTTGGGCTCTGGCTGTGGTCTGG - Intergenic
1091402339 12:188736-188758 CCTGTACTGGTGCTCTGGGCAGG + Intergenic
1091698929 12:2647320-2647342 CCTGGAGCCTGGATCTGGGAAGG - Intronic
1091988771 12:4937481-4937503 CCAGCACTCTGTCTCTGTGCAGG - Intergenic
1092064334 12:5577498-5577520 CGTGGACTCTGGCACTGCGTAGG - Intronic
1092526393 12:9312613-9312635 CCTGGCCGGGGGCTCTGGGCTGG - Intergenic
1092529842 12:9335153-9335175 CCAGGACTGTGGCTCCAGGCAGG - Intergenic
1092540878 12:9419172-9419194 CCTGGCCGGGGGCTCTGGGCTGG + Intergenic
1094512164 12:31103313-31103335 CCTGGCCGGGGGCTCTGGGCTGG - Exonic
1095048192 12:37533417-37533439 CCTGGGGTCTGGCCCTGGGTTGG - Intergenic
1096525361 12:52207092-52207114 CCTGGACTCTAGTGCTGGGGTGG + Intergenic
1096588869 12:52644113-52644135 CCTGGCCTCTGTCTCTGCGGGGG - Intergenic
1097174084 12:57132900-57132922 ACTGGACACTGGGTCTGGCCAGG - Intronic
1097580375 12:61448186-61448208 CCTTACCTCTGGCTCTGGGCAGG + Intergenic
1098414160 12:70214692-70214714 CATGGACTCGGGCTTTAGGCTGG - Intergenic
1100174175 12:92010590-92010612 CCTGGACTCTTGATCTGAGCTGG - Intronic
1101860059 12:108475511-108475533 CCAGGGCATTGGCTCTGGGCTGG - Intergenic
1101941040 12:109098975-109098997 CCTTGCCTCTTTCTCTGGGCTGG - Intronic
1102025288 12:109711169-109711191 CCGGAACACTGGCTCTGGCCAGG - Intergenic
1103099625 12:118161941-118161963 CCTGTACTCTAGCTCTCGGGTGG + Exonic
1103639180 12:122335369-122335391 CCTTGAGTCTGGCTGTGGGATGG - Intronic
1104313561 12:127676206-127676228 CCTGGGCTGTGGCTCTGTGACGG - Intergenic
1104401850 12:128482854-128482876 GCTGGACTCTTGCTCTGTGCAGG - Intronic
1104624991 12:130344726-130344748 CCTGGAATCTGGATCTGGCAGGG - Intronic
1104917517 12:132273536-132273558 CCTGGCCCCTGGCCCTGTGCTGG + Intronic
1105503452 13:20991160-20991182 CCAGGAGACTGGCTCTGGCCAGG + Intronic
1105771217 13:23613832-23613854 TTGTGACTCTGGCTCTGGGCTGG - Intronic
1106762469 13:32880693-32880715 CCAGGCCTATGGCTCTGGGTTGG - Intergenic
1107022312 13:35764510-35764532 CCTGGACTCTGGTTTTAGGAGGG + Intergenic
1111530458 13:89530006-89530028 CCTGGACTCAGCCTCTCAGCTGG + Intergenic
1112043368 13:95570616-95570638 CCAGGACTCTGGCCCGGGCCAGG - Intronic
1112905280 13:104410716-104410738 CTTGGATTCTGGCTGTGGTCGGG + Intergenic
1113693275 13:112326907-112326929 CCTGGGCCCTGGCTCTGAGGTGG + Intergenic
1116657837 14:47674301-47674323 CCTGGGCTCTGGCTCGGAGTTGG - Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1119687953 14:76647843-76647865 CCTGCACTTTGGCTTTGGGATGG + Intergenic
1121221425 14:92288375-92288397 CCTGGGCGCTGCCTCTGAGCAGG + Intergenic
1121556268 14:94840092-94840114 CCTGAGCTCTAGCTGTGGGCAGG - Intergenic
1121601011 14:95202960-95202982 CCTGGTCGCTGGCACTGGGGAGG + Exonic
1121741096 14:96252881-96252903 CCTGGGTGCTGGCTCTGGGGTGG - Intronic
1122227218 14:100286785-100286807 CCTGGACCCTTGCCCTGGCCAGG + Intergenic
1122625750 14:103084566-103084588 ACTGGACCCTGGCGCCGGGCAGG + Intergenic
1122655751 14:103258353-103258375 CCTGGATTCCGGCCCTGAGCTGG - Intergenic
1122838511 14:104443144-104443166 CCGGGCCTCTGACTCTGGGGTGG - Intergenic
1122891242 14:104733222-104733244 TCAGGACAGTGGCTCTGGGCGGG - Intronic
1122959948 14:105089813-105089835 TCTGGGCTCTGGGTCTGGGTGGG - Intergenic
1123921273 15:25071452-25071474 CCTTGGCTCTGGCTCTGCCCTGG + Intergenic
1126849123 15:52786960-52786982 CCTGAAGCCTGGCTCTGGGGTGG + Intronic
1128078232 15:64841605-64841627 CCTCGCCTCAGTCTCTGGGCCGG + Intergenic
1128302959 15:66578704-66578726 CCAGGTCCTTGGCTCTGGGCTGG - Intergenic
1128600773 15:68993717-68993739 CCTTAACTCAGGCCCTGGGCAGG - Intronic
1129385766 15:75195559-75195581 GCTTGGCTCTGGCTCAGGGCTGG - Intergenic
1129606543 15:77027979-77028001 CCTGGGCTGTGGCCCCGGGCAGG + Intronic
1129734351 15:77951539-77951561 CCTGGGATCTGGTGCTGGGCTGG - Intergenic
1129753215 15:78080301-78080323 CCTGGACTAAGAGTCTGGGCTGG + Intronic
1129841235 15:78744452-78744474 CCTGGGATCTGGTGCTGGGCTGG + Intergenic
1130426345 15:83805000-83805022 CCTTCACACTGTCTCTGGGCAGG + Intronic
1130979516 15:88803251-88803273 GCTGGACCCTGGCTCCGGACCGG - Intergenic
1131176253 15:90211468-90211490 ACTCGACTCTGGCACTGGGCTGG + Intronic
1131737759 15:95352028-95352050 TCTGGACTCTGACTCTCAGCTGG + Intergenic
1132394948 15:101465497-101465519 GCTCCACTCTGGCTCTGAGCTGG + Intronic
1132465266 16:74554-74576 CCTGGACACAGGCTCTGAGCTGG - Intronic
1133729876 16:8569866-8569888 GCTGGTCCCTGGCCCTGGGCTGG - Exonic
1134105410 16:11482218-11482240 CCTGGACACTGTCTCCAGGCAGG - Intronic
1134109862 16:11508501-11508523 CCTGGACTGGGGCACTGGCCTGG + Intronic
1134392320 16:13831153-13831175 TCTGGTATCTGGCTCTGGGGTGG - Intergenic
1134803486 16:17106337-17106359 CCCGGCCTCTGCCTCTGGCCAGG - Exonic
1135732603 16:24907224-24907246 CCTGGACTTTGCCTCTGGGTGGG - Intronic
1136089859 16:27911057-27911079 CCTTGACTGGGGCTCAGGGCAGG - Intronic
1137266298 16:46871646-46871668 CCTGGAATCTGGCTCTATGTTGG + Intergenic
1137550605 16:49434987-49435009 GCTGGAATCTGCCTTTGGGCTGG - Intergenic
1137785541 16:51134729-51134751 CCAGAACTCTGGTTCTGCGCGGG - Intergenic
1138210071 16:55156030-55156052 CCTGGGCTCTGTCACTGGGCGGG + Intergenic
1138216279 16:55207769-55207791 CCTGGACTCTGGCTGTCAGGGGG - Intergenic
1138248224 16:55482802-55482824 TCTGGACTATGGCACTGGGTTGG + Intronic
1138446898 16:57070346-57070368 CCAGGGCTCAGGCTCTGGGTAGG - Intronic
1138534785 16:57654085-57654107 CCTGGAGGCCGGCTGTGGGCTGG - Exonic
1138572829 16:57886586-57886608 CCTGGACTCTGACACCAGGCTGG + Intronic
1138583957 16:57958595-57958617 CCTGGGCTCTGGCTCCTGGCAGG - Intronic
1139588849 16:67921840-67921862 CCTCCACTCTGGCTCTGGGCAGG + Intronic
1139910558 16:70395010-70395032 GCGGGGCTCTGGCTATGGGCAGG - Exonic
1141184924 16:81780022-81780044 CCTGAACTCTTGCGCTGTGCGGG - Intronic
1141207991 16:81948625-81948647 GCTGCACTCTGGCACTGAGCTGG + Intronic
1141438406 16:84014018-84014040 CCTTCCCTCAGGCTCTGGGCGGG - Intronic
1141559723 16:84859365-84859387 ACTGGACACTGGCTCTGAGCAGG - Intronic
1141981797 16:87555171-87555193 CCTGGACGCTGGCGATGGGCGGG - Intergenic
1141984599 16:87571664-87571686 CCTTGCCTCTGTCACTGGGCAGG - Intergenic
1142204576 16:88776743-88776765 GCTGGACCCTGGCTCGGGGCGGG + Intronic
1142234048 16:88913088-88913110 CCTGCCCCCTGGATCTGGGCTGG + Intronic
1142238020 16:88931749-88931771 CATGGTCCCTGGGTCTGGGCAGG + Intronic
1142247986 16:88978498-88978520 CCTGTGCTCTGGCTCAGGGTGGG + Intergenic
1142853661 17:2717817-2717839 CCTGAACTGTGACTCTGGGATGG + Intergenic
1143508168 17:7380996-7381018 CCTGGCCGCTGGCCCGGGGCCGG - Exonic
1143517537 17:7427272-7427294 CCTGGACTTTGGGCCAGGGCTGG - Exonic
1143593036 17:7897151-7897173 CCTGGACTATGGCTCCGGCGAGG + Exonic
1143773061 17:9180563-9180585 CCTGGACCCTGGATCTGGGTGGG + Intronic
1144142290 17:12361538-12361560 CCTGGGCCCTGACTCTGGGGTGG - Intergenic
1144415495 17:15042421-15042443 CCTGGACTGTGGGTGTGGGAGGG + Intergenic
1144658060 17:17050752-17050774 CCTAAACTCTGCCTCTGGGCAGG - Intronic
1144871863 17:18376868-18376890 CCTGGGCTCTGGCTGAGGCCCGG - Intergenic
1147319076 17:39635324-39635346 CCTGGGTGCTGGCGCTGGGCTGG + Intronic
1147389439 17:40100170-40100192 CCTGGGCACTGGCTAAGGGCGGG + Exonic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1147608260 17:41786268-41786290 CCCTGACTCTCGCCCTGGGCTGG - Intronic
1148130047 17:45257013-45257035 CCTGGACACTGGCCCCGGGGAGG + Intronic
1148835579 17:50464072-50464094 CCTGGCAGCTGGCCCTGGGCTGG - Intronic
1149439715 17:56664054-56664076 CCTGGCCTCCTTCTCTGGGCAGG - Intergenic
1149556362 17:57576151-57576173 GCTGAACACTGGCTCTGTGCTGG + Intronic
1150576525 17:66435559-66435581 CCTGGACTAGGCCTCTGGGAGGG + Intronic
1151577874 17:74962052-74962074 CCTGGGCTGGGGCGCTGGGCTGG - Intronic
1151749428 17:76028198-76028220 CCTGGGCTCTGGCTGAGGCCCGG + Intergenic
1151759339 17:76091658-76091680 CCTGGAGTTTGGGGCTGGGCTGG - Intronic
1151797153 17:76353898-76353920 CCTTGCCTCTGGCTCTGAGGCGG - Exonic
1151877119 17:76873117-76873139 CATGCACTTTGGCTCTGGTCTGG + Intronic
1152036370 17:77875559-77875581 TCTTGAATCTGCCTCTGGGCAGG + Intergenic
1152083966 17:78205937-78205959 CCTTGACACAGGGTCTGGGCAGG - Exonic
1152133608 17:78491641-78491663 CCTGGCCTCTCTCTCTGGGAGGG + Intronic
1152244417 17:79177659-79177681 CCTGCACCCAGGCTCTGGGATGG - Intronic
1152626605 17:81390573-81390595 TGTGGCCTCTGGCTCTGGGGAGG - Intergenic
1152706286 17:81845265-81845287 CCAGGAGATTGGCTCTGGGCCGG - Intronic
1152929344 17:83101933-83101955 GCTGGACTCAGGCTCGGGGGAGG - Intergenic
1155346947 18:24866760-24866782 CCTGGACTTTGGCTCTGTCCAGG + Intergenic
1155893477 18:31294500-31294522 CCTGTGCTCAGACTCTGGGCTGG - Intergenic
1156457039 18:37300587-37300609 CCTGAGCTCCTGCTCTGGGCAGG + Intronic
1156497317 18:37534370-37534392 CATGGGCTCTGTCACTGGGCAGG + Intronic
1156513725 18:37662327-37662349 CCTGGACTGAGGCTCCTGGCTGG + Intergenic
1158721285 18:59927371-59927393 CCTGGACTTTCCCTTTGGGCAGG - Intergenic
1160215981 18:76932039-76932061 CTGGGACTGTGACTCTGGGCAGG + Intronic
1160333405 18:78016017-78016039 CCTGCAGTCTGGCTCTGGTGGGG - Intergenic
1160572291 18:79826318-79826340 CCTGGAGCCTGGCTCTGGAGGGG - Intergenic
1160817073 19:1041090-1041112 CCAGGACTGTCGCTCTGAGCAGG - Intronic
1161014355 19:1976291-1976313 CCTGGTCCCTGGCTCAGGACTGG + Intronic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161960533 19:7520625-7520647 CCCTGACCCTGGCTCTGGGCCGG + Exonic
1162378013 19:10316429-10316451 GCTGGTTTCTGGCACTGGGCTGG + Exonic
1162407792 19:10486108-10486130 CTTTCACCCTGGCTCTGGGCTGG - Exonic
1162500531 19:11050920-11050942 CCTGGACCCTGGTGCTGTGCAGG + Intronic
1162841396 19:13359081-13359103 CATGGAATCTGGCCATGGGCAGG + Intronic
1163124942 19:15239624-15239646 CCTGAGCCCTGGCTGTGGGCAGG + Intronic
1163427444 19:17246926-17246948 GCGAGCCTCTGGCTCTGGGCAGG + Intronic
1165729448 19:38135373-38135395 GCTGGGCTGTGGCTCCGGGCAGG - Intronic
1165895473 19:39138699-39138721 CCTGGACCCTGGCGGAGGGCGGG + Intronic
1166788742 19:45385226-45385248 CCTGGCATAGGGCTCTGGGCAGG - Intronic
1167285992 19:48599276-48599298 CTTGGGCTCAGGCTCAGGGCTGG - Exonic
1167620812 19:50559470-50559492 CCTGGACTGTGATTCTGTGCTGG + Intronic
925505233 2:4554947-4554969 CCAAGACTCTGGGTCTAGGCAGG + Intergenic
925947008 2:8874630-8874652 CTGGGACTCTGGGTCTGGGCAGG - Intronic
926152433 2:10432574-10432596 CCTGGGCTCCGGCTCCGGGTCGG + Intergenic
926247857 2:11133738-11133760 GCTCGGGTCTGGCTCTGGGCTGG - Intronic
926801419 2:16664184-16664206 TCTGGGCTCTGGCTCTGGGAAGG - Intronic
927053528 2:19351044-19351066 CCTGGCCTCTGGCTTTGGGGTGG - Intergenic
927194695 2:20539413-20539435 CCTGGACACTGCCCCTGGCCTGG - Intergenic
927210435 2:20635909-20635931 CCTGGGCTCCGGCTTTGTGCTGG + Intronic
927555000 2:24024985-24025007 CTTGGCCTCAGGCTCTGTGCTGG - Intronic
932061270 2:68500888-68500910 GCTGTCCTCTGGCTCTTGGCAGG - Intronic
932564011 2:72894399-72894421 CTTGGACACTGGCTTTGGCCTGG - Intergenic
932751286 2:74373315-74373337 CGGGGCCTCTGGCTCTGGACTGG - Intronic
933523863 2:83410558-83410580 CCTCCTCTCTGGCTCAGGGCAGG + Intergenic
934515258 2:94982243-94982265 CCTGGACTCGGGCTTAGGGGAGG - Intergenic
934555183 2:95283268-95283290 CCTGGGCTCTGGTCCTTGGCAGG + Intronic
934574393 2:95391077-95391099 GCTGCACTCTGGCGCTGTGCAGG - Intergenic
934613650 2:95758252-95758274 CATGGCATCTGGCTCTGGGCAGG - Intergenic
934619361 2:95794544-95794566 CCTGAGCTTTGGCCCTGGGCAGG + Intergenic
934641531 2:96030013-96030035 CCTGAGCTTTGGCCCTGGGCAGG - Intronic
934647249 2:96066163-96066185 CATGGCATCTGGCTCCGGGCAGG + Intergenic
934840623 2:97621983-97622005 CATGGCATCTGGCTCTGGGCAGG + Intergenic
936979684 2:118253110-118253132 CCTGGCCTTTAGCTCTGGTCTGG - Intergenic
937006786 2:118523911-118523933 ACTGGACTCTGGCTCTGAACTGG + Intergenic
937460181 2:122078727-122078749 TCTGGACTCTGGATCTTAGCAGG + Intergenic
937883111 2:126883025-126883047 CTTGGCCTCTGGCTGCGGGCTGG - Intergenic
938143135 2:128812573-128812595 GCTGGAGTCTGGCAGTGGGCTGG + Intergenic
938328088 2:130427813-130427835 CCTGGCCTCGGGCTCGGCGCAGG - Intergenic
938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG + Intergenic
939325444 2:140682488-140682510 CCTGGACACTTGCCTTGGGCTGG + Intronic
941953480 2:171180165-171180187 ACTGCACTCTGGCTCTGGCCTGG + Intronic
944863818 2:203841011-203841033 CCTGGTCTGTGGCTTTGTGCTGG - Intergenic
946332263 2:219017146-219017168 CCTAGATGCTGGCTCTGGGCTGG - Intronic
947524221 2:230868685-230868707 CCTGGTCTCAGGCCCTCGGCAGG + Intronic
947535196 2:230935647-230935669 CCTGGGCTCTGGGACTGGGCTGG + Intronic
947815656 2:233034628-233034650 CCTGGACCCTGGCTCGGAGGTGG - Exonic
947841052 2:233208300-233208322 CCCGCACTGTGCCTCTGGGCGGG - Intergenic
948237220 2:236400246-236400268 GCTAGACTCTGGCTCCGGGAAGG - Intronic
948508661 2:238448445-238448467 CCTGCACTCTGGCTCTTTACTGG + Exonic
948658149 2:239489671-239489693 CGTGGCCTCTGGCTCCTGGCTGG + Intergenic
1169112547 20:3043396-3043418 CCAGGACTCTTGCTTTAGGCTGG - Intergenic
1170821913 20:19761267-19761289 CATGGAGTGTGCCTCTGGGCAGG - Intergenic
1170836126 20:19886195-19886217 CCTGGACCCTGGCTGTGGGCTGG - Intergenic
1171227226 20:23451849-23451871 CGTGGTCTCTGGCTTTTGGCAGG + Exonic
1172225392 20:33302143-33302165 CCTGGACTTTTACTGTGGGCTGG - Intronic
1172608264 20:36230424-36230446 CCTGGACTCTGGGTGTGGGTTGG + Exonic
1172751372 20:37253505-37253527 CCTGGCCTCTGGCTCCGCACTGG + Intronic
1172869356 20:38126286-38126308 CCTGGACTCCGGATCAGAGCTGG - Intronic
1172941759 20:38659140-38659162 CCTGGTACCTGGCTGTGGGCAGG + Intergenic
1173158248 20:40633099-40633121 CCTGAGCTCAGGCTCTGTGCTGG - Intergenic
1173649781 20:44655813-44655835 CCTGCCCTCTGGCTCTGGTTGGG + Intergenic
1174947723 20:55006845-55006867 CCTGGACACTGGGGTTGGGCGGG + Intergenic
1175178069 20:57125651-57125673 CCTGGTCTCTTGCTCAAGGCAGG + Intergenic
1175583624 20:60120106-60120128 GCTGGACTCTGGTTCAGAGCCGG - Intergenic
1175797144 20:61778854-61778876 CCAGAATTCTGGCTCTGGACTGG + Intronic
1175990976 20:62788996-62789018 GCTGGTCTCTTGCTCTAGGCAGG + Intergenic
1176866844 21:14058712-14058734 CCTGGACCCTGGCCCTGGCCTGG - Intergenic
1179129015 21:38617855-38617877 AATGGAATCTGTCTCTGGGCAGG + Intronic
1181027073 22:20132479-20132501 ACTTGACTCTGGCCCGGGGCGGG - Intronic
1181615817 22:24053714-24053736 CCTGGATGCTGGCTCTGTGCAGG + Intronic
1181805613 22:25372878-25372900 CCTGGGCTCTGGGGCTGGGTGGG - Intronic
1182423690 22:30260785-30260807 CCTGGACCCAGACTCTGGACAGG + Intergenic
1183187506 22:36300419-36300441 CCTCGGCTGTGGCCCTGGGCTGG - Intronic
1183549614 22:38474224-38474246 CCTGGGCTCTTGCTCTGGGGAGG - Intronic
1184212288 22:43043239-43043261 CCTGGCCTCTGCTTCTTGGCCGG + Intronic
1184607138 22:45580658-45580680 CCTGGGCTCCGGCTCTGGGCGGG - Intronic
1184643046 22:45882380-45882402 CCTGGACTGTGGCCCTTGTCGGG - Intergenic
1184644846 22:45890115-45890137 CCAGGACCCTGCCTCTGGGGTGG - Intergenic
1185036381 22:48479325-48479347 CCTGGCCGCAGGCTCAGGGCGGG - Intergenic
1185036416 22:48479457-48479479 CCTGGCCGCAGGCTCAGGGCAGG - Intergenic
1185036433 22:48479523-48479545 CCTGGCCGCAGGCTCAGGGCAGG - Intergenic
1185036450 22:48479589-48479611 CCTGGCCGCAGGCTCAGGGCAGG - Intergenic
1185050622 22:48552286-48552308 CCAGGAGTTGGGCTCTGGGCAGG + Intronic
1185316081 22:50179668-50179690 CCTCTTCCCTGGCTCTGGGCTGG - Exonic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
950390609 3:12693781-12693803 CCTGGCATCTGGAACTGGGCTGG - Intergenic
951321241 3:21248618-21248640 CCTCCACTTTGACTCTGGGCTGG + Intergenic
952841783 3:37652635-37652657 CCTGGACTTATTCTCTGGGCAGG + Intronic
953758164 3:45665751-45665773 CCTGCCCTCTGACTCTGGCCAGG - Intronic
953848681 3:46449075-46449097 GCAGGACCCTGGCTCTGGGGAGG - Intronic
954155358 3:48682221-48682243 CCTGAGCCCTGGCTGTGGGCAGG + Intronic
954444589 3:50539902-50539924 CCAGGCCTCTGGACCTGGGCAGG + Intergenic
954453459 3:50584215-50584237 CCAGGACTCTGGCTGGGGGCTGG - Exonic
954672132 3:52296865-52296887 GCTGGCCTCTGGCACTAGGCAGG + Intergenic
954797313 3:53168176-53168198 CCTGGAGTCAGCCTGTGGGCTGG + Intronic
955344600 3:58151793-58151815 CCTGTGCTCAGGCTGTGGGCTGG + Intronic
955842182 3:63124376-63124398 CCTGGGATCTGGCCCAGGGCAGG - Intergenic
961335738 3:126178973-126178995 CCTGGACTCTGCCTCCCTGCAGG - Intronic
961683916 3:128616932-128616954 CCTGGACCCTGGCTCAGGGAGGG - Intergenic
962346845 3:134624857-134624879 AATGGCCTCTGGCTCTGGGCAGG + Intronic
962414369 3:135168699-135168721 CCCTGACTCTTGCTCAGGGCTGG + Intronic
963231056 3:142909197-142909219 CCTGTACTTGGGCTCTGAGCTGG - Intergenic
967388077 3:188929709-188929731 CCTGGCCTCTGGCAGTGGGCTGG - Intergenic
968439931 4:618180-618202 CCTGGACTCAGCCTCAGGGGAGG - Intergenic
968944020 4:3654264-3654286 CCTGGAGGCTGGGTCTGGCCAGG - Intergenic
968964024 4:3760449-3760471 CCTGGACTCTGGGTTCGAGCTGG - Intergenic
968972369 4:3802691-3802713 CCTGGACTCTGGGGCAGGGGAGG + Intergenic
969091664 4:4698564-4698586 GGTGGACTCTGGCTCAGAGCAGG + Intergenic
969162221 4:5270951-5270973 ACAGCACTCTGTCTCTGGGCGGG - Intronic
969293860 4:6257636-6257658 CATGGACGAAGGCTCTGGGCTGG + Intergenic
969476947 4:7427237-7427259 GCTGGACTCAGGCTCTGGGGGGG + Intronic
969672975 4:8599802-8599824 CATGGTCACTGGCTCTGTGCCGG + Intronic
971264477 4:25085764-25085786 TTTGGAGGCTGGCTCTGGGCAGG + Intergenic
972359338 4:38313299-38313321 CCTGGACTCTTCACCTGGGCGGG + Intergenic
972805712 4:42528011-42528033 ACTGGACACTGGCTCTGAGCTGG + Intronic
973678258 4:53287522-53287544 CATTGACTCTGGTTCTGGGCGGG - Intronic
974028824 4:56757529-56757551 CCTGCATTCTGGCTGTGGCCTGG - Intergenic
976116823 4:81736682-81736704 CCTGGCCACTGGTTCTGGGTCGG - Intronic
977338713 4:95730154-95730176 CCTGGAGTCTGGCTCTCTCCTGG + Intergenic
977503986 4:97878671-97878693 CCTGGCCTCTGGGTCTGTGATGG + Intronic
978334221 4:107648503-107648525 CTGGGGCTCTGGCTGTGGGCTGG - Intronic
978802540 4:112769340-112769362 CCCCGACTCTGACTCTGTGCTGG - Intergenic
981272301 4:142859233-142859255 ACTGGACACAGGCTCTGGGAGGG - Intergenic
984707111 4:182855658-182855680 CCTGGACTCTTGCTCTGCAGTGG - Intergenic
985646894 5:1089194-1089216 GCTGCACTCAGGCCCTGGGCAGG + Intronic
985727111 5:1522415-1522437 GCTGGACTCTGGGGCTGGGGCGG - Intronic
985775856 5:1841346-1841368 CCTGGACTGGGGCACTGGCCTGG + Intergenic
987555085 5:19436058-19436080 CCTGGACTCTTGCTGGAGGCTGG + Intergenic
987673407 5:21044268-21044290 CCTGGAGTCAGGCGCTGAGCAGG + Intergenic
990749847 5:59002635-59002657 CCTCAGGTCTGGCTCTGGGCTGG - Intronic
992464285 5:76988386-76988408 CCTGTACTGTGATTCTGGGCTGG - Intergenic
992570832 5:78055231-78055253 CCTGCACTGTGGCACTGGCCAGG + Intronic
995702093 5:114947617-114947639 CCTGGACTTTGGCTCATTGCTGG - Intergenic
997163574 5:131634997-131635019 CGTGGACCCTGGCGCTAGGCAGG - Exonic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997425694 5:133801241-133801263 GTTGGTCTCTGGGTCTGGGCTGG - Intergenic
997432686 5:133851674-133851696 CCACCACTCTGGCTCTGGTCTGG + Intergenic
997590609 5:135069862-135069884 CCTGCTCTCAGGCTCTGTGCTGG + Intronic
997700220 5:135892581-135892603 CACCGACTCTGGCTCTTGGCAGG - Intronic
998397286 5:141826812-141826834 CCTGGGCCCTGTCTCTAGGCCGG + Intergenic
999319749 5:150606562-150606584 ACTGGGCTCTTGCTCTGCGCCGG + Intronic
1001705446 5:173738025-173738047 CATCGACTCTGGCCCTGTGCTGG - Intergenic
1002350193 5:178577646-178577668 CCTTGACACTCGCTCTGGTCTGG - Intronic
1002698948 5:181109145-181109167 CCTGGACGCATGCTCTGGTCTGG + Intergenic
1003979821 6:11379110-11379132 CCTGGCCTGTGCCACTGGGCTGG - Intronic
1006001333 6:30967425-30967447 ACTGGACACTGGCTCTGAGCTGG + Intergenic
1006075285 6:31528834-31528856 CCTGGACTCTGTCTGGGGCCAGG + Exonic
1006275843 6:33005144-33005166 CCTGGACCTTGGCTGTGGTCTGG - Exonic
1007131893 6:39482939-39482961 CCTGGGCTCTGGTTCTAGGTTGG - Intronic
1007412535 6:41673362-41673384 GCTGGGCTCAGGCACTGGGCTGG - Intergenic
1007775381 6:44222027-44222049 CCTGGTCTCTGGGTCTGTGGGGG - Intronic
1008540061 6:52538466-52538488 CCTGGGCTCTGGGTCTTGGGCGG + Intronic
1012542377 6:100376282-100376304 CCTCGACTCAGGCTCAGGGGAGG - Intergenic
1013626772 6:111945648-111945670 TGTGGACTCTGGATCTGGACTGG - Intergenic
1014645051 6:123962852-123962874 GCTTTACTCTCGCTCTGGGCAGG - Intronic
1016377940 6:143443263-143443285 CCTGGAATCTGGCCCTTGGTAGG - Intronic
1016809117 6:148242864-148242886 CATGGGCTCTGGCTCTATGCTGG + Intergenic
1018834853 6:167474967-167474989 CCTGGGCCCTGCCTCTGGGCAGG - Intergenic
1019038119 6:169078932-169078954 ACTCAAATCTGGCTCTGGGCAGG + Intergenic
1019279978 7:194703-194725 CCTGGGCTGTGGCTCTCGGCAGG + Intronic
1019300236 7:299388-299410 CCTTGGCCCTGGCTCGGGGCAGG - Intergenic
1019494746 7:1332461-1332483 CCTGGTCTCTGGCTTGGGGCTGG + Intergenic
1019575722 7:1736775-1736797 CTGGGACTCTGGCTCTGGCCCGG + Intronic
1019623060 7:2002006-2002028 CCTGGACCCTGGGTCTGGGCAGG - Intronic
1019711608 7:2520506-2520528 CCAGGACTCTGGAGCTGGACAGG - Intronic
1019996113 7:4725470-4725492 CCGGGCCTCTGCCTGTGGGCAGG - Intronic
1021583250 7:22179095-22179117 CTTGGTCTCTGCCACTGGGCTGG - Intronic
1021867365 7:24971502-24971524 TCTGGACTCTGGGTGTGGGAGGG - Intronic
1022042458 7:26593437-26593459 AATGGACGGTGGCTCTGGGCAGG - Intergenic
1022352071 7:29575810-29575832 CATGGCCTCTGGCTTTGGGATGG - Intergenic
1022473532 7:30695788-30695810 TCTGGAGTCAGGCTGTGGGCCGG + Intronic
1022975228 7:35550252-35550274 CCTGCATTCAAGCTCTGGGCTGG - Intergenic
1023586668 7:41738142-41738164 CCTGGACACTGGTTCGGGGGCGG - Intergenic
1023849897 7:44144781-44144803 CCTGGGCCCAGGCTCTGGGAAGG - Exonic
1024030262 7:45454718-45454740 CCTGGCCTCTGGTACTGTGCAGG + Intergenic
1024046122 7:45586935-45586957 CCTGCACTCTTGCTCTGCTCAGG + Intronic
1024249512 7:47495662-47495684 CCTGGGCCCTGGCTCTGGCTGGG - Intronic
1024926373 7:54619382-54619404 CTGGGTCTCTGGCTCTGGGATGG + Intergenic
1025712910 7:63928037-63928059 ACTGTGTTCTGGCTCTGGGCTGG + Intergenic
1025999207 7:66548373-66548395 CCTGGACGATGGACCTGGGCTGG - Intergenic
1026655511 7:72253105-72253127 CCTGGACTTAGTCTCTTGGCTGG + Intronic
1026977056 7:74505409-74505431 CCTGGGCTGTGGCTCGGGACAGG + Intronic
1028288934 7:89041286-89041308 CCTGGAGTCTGGGTCTGCCCTGG + Intronic
1028636440 7:92994521-92994543 CTTGGAATCTGGTTCTGGGTTGG + Intergenic
1029260509 7:99299501-99299523 CTTGGCCTCTGCCTCTAGGCTGG - Intergenic
1029420540 7:100469636-100469658 CCTGCACTCTGGCGCTGTGGCGG + Intronic
1029700856 7:102246115-102246137 CCTGTACTCTGGTTTTGGGTCGG + Intronic
1031990281 7:128192899-128192921 TTCGGGCTCTGGCTCTGGGCGGG + Intergenic
1032089384 7:128903755-128903777 CCTCAGCACTGGCTCTGGGCAGG + Exonic
1033169349 7:139069918-139069940 CCTGTACGCTGGCTCAAGGCAGG + Intronic
1033728499 7:144147466-144147488 CCTGGAACCTGGGTCTGGCCTGG - Intergenic
1033755745 7:144397399-144397421 CCTGCCCCCAGGCTCTGGGCAGG - Exonic
1034277830 7:149831343-149831365 CATGGACTCTGGTTCTGCCCAGG - Intergenic
1034285455 7:149880716-149880738 CCTGGCCTCTGCCTGTGTGCAGG + Intergenic
1034392690 7:150799684-150799706 GCTGGAATCTGGGGCTGGGCTGG - Intronic
1034867015 7:154650389-154650411 CCAGTAGCCTGGCTCTGGGCTGG + Intronic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1036100223 8:5774111-5774133 CCTGGACTAGGGCTGTGTGCTGG + Intergenic
1036127424 8:6075755-6075777 CGTGGGCTTTGGCTCTGGGGTGG + Intergenic
1036225978 8:6958002-6958024 ACTGGACTCCCCCTCTGGGCCGG + Intergenic
1037990010 8:23315055-23315077 CCTTGGCTCTGGCTTTGGGGAGG + Intronic
1039079063 8:33718096-33718118 GCTGGCCTCTGGCCCTGGGGGGG + Intergenic
1039546352 8:38413885-38413907 CCTGAGCTCTGGCTCTGGCACGG + Intronic
1040593806 8:48819197-48819219 CCAGGAATCTGGCTCTGACCAGG - Intergenic
1042802745 8:72738335-72738357 CCTGAACTCTGACTGTAGGCAGG + Intronic
1042880357 8:73481284-73481306 CTTAGACTCTGGCTTTGCGCTGG - Intronic
1044467638 8:92525860-92525882 CCTGTACTCAGGCCCTGGGTTGG - Intergenic
1044859817 8:96512055-96512077 CCTTGACTCTGTCTCCTGGCTGG - Intronic
1047182845 8:122605731-122605753 CCTGGTCTCCTGCTCTGGTCTGG - Intergenic
1047367800 8:124228259-124228281 CCTGCACTCTTGCCCTGGGATGG - Intergenic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1047602173 8:126436782-126436804 CCTTGACACTAGCTCTGGGAGGG - Intergenic
1047623794 8:126635130-126635152 GCTGCACTGTGGCTCAGGGCAGG + Intergenic
1048468284 8:134685400-134685422 CCATGACGCTGGCTGTGGGCTGG - Intronic
1048903971 8:139069154-139069176 ACTGGACTTTGGCACTGTGCTGG + Intergenic
1048915109 8:139175212-139175234 CCTTGGCTCTGGCAATGGGCTGG + Intergenic
1049195295 8:141312482-141312504 GCTGGCCTCTGGCTCAGAGCAGG - Intergenic
1049203637 8:141353371-141353393 CCACGACTCTGGTCCTGGGCTGG - Intergenic
1049310216 8:141930219-141930241 GCTGAGCTCTGCCTCTGGGCTGG - Intergenic
1049355294 8:142184719-142184741 CCTGGGCTCTGGTTTTGTGCAGG - Intergenic
1049358293 8:142199477-142199499 CTGGGCCTGTGGCTCTGGGCAGG + Intergenic
1049442326 8:142615059-142615081 CCTGGACTCAGGACCCGGGCAGG - Intergenic
1049462538 8:142736778-142736800 CCTTGACTCTGGCTCAAGGTGGG - Exonic
1050015796 9:1232535-1232557 GCTGGACTCTGGCTATGGATGGG + Intergenic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1052820805 9:33136828-33136850 CCTGCTCACTGGCCCTGGGCGGG - Intronic
1053123179 9:35560925-35560947 GCTGGACTCAGGCTCTGCCCAGG - Intronic
1053123199 9:35561025-35561047 CTTGGGCTCTGGCTCCCGGCGGG - Exonic
1053164323 9:35833849-35833871 CCTGTATACTGGCTCAGGGCAGG - Intronic
1053489692 9:38489220-38489242 GCTGCTGTCTGGCTCTGGGCAGG + Intergenic
1053572751 9:39327098-39327120 CCTGGTCTCTGTCTCTGCGTAGG - Intergenic
1053624101 9:39851319-39851341 CCTGGTCTCTGTCTCTGCGTAGG - Intergenic
1053802448 9:41772984-41773006 CCTGGCCTCTGCCCCTGGGGAGG + Intergenic
1053880768 9:42591910-42591932 CCTGGTCTCTGTCTCTGCGTAGG + Intergenic
1054094313 9:60885808-60885830 CCTGGTCTCTGTCTCTGCGTAGG - Intergenic
1054115784 9:61161715-61161737 CCTGGTCTCTGTCTCTGCGTAGG - Intergenic
1054124393 9:61291913-61291935 CCTGGTCTCTGTCTCTGCGTAGG + Intergenic
1054142790 9:61542086-61542108 CCTGGCCTCTGCCCCTGGGGAGG - Intergenic
1054190757 9:61984330-61984352 CCTGGCCTCTGCCCCTGGGGAGG + Intergenic
1054219796 9:62399380-62399402 CCTGGTCTCTGTCTCTGCGTAGG + Intergenic
1054230919 9:62509793-62509815 CCTGGTCTCTGTCTCTGCGTAGG - Intergenic
1054462538 9:65473236-65473258 CCTGGCCTCTGCCCCTGGGGAGG - Intergenic
1054591972 9:67020827-67020849 CCTGGTCTCTGTCTCTGTGTAGG + Intergenic
1054647617 9:67603387-67603409 CCTGGCCTCTGCCCCTGGGGAGG - Intergenic
1056649465 9:88445570-88445592 GATGGAGTCTTGCTCTGGGCTGG + Intronic
1057197684 9:93123999-93124021 GCTGGACCCTGGCTGTGTGCAGG - Intronic
1057695297 9:97318696-97318718 CCAGCTCTCTGGCCCTGGGCTGG + Intronic
1057695364 9:97319097-97319119 CCAGCTCTCTGGCCCTGGGCTGG - Intronic
1057819747 9:98321891-98321913 GCTGGGCTGTGGCCCTGGGCAGG - Intronic
1060137134 9:121168403-121168425 CCTGGGCTCTGGCTGGGGTCCGG - Intronic
1060225143 9:121785914-121785936 ACTGAAATCTGGCTCTGGGAGGG + Intergenic
1060825246 9:126684038-126684060 CATGGAGGCTGACTCTGGGCTGG - Intronic
1060972129 9:127744411-127744433 CCTGCTCTGTGACTCTGGGCTGG - Intronic
1061540432 9:131275456-131275478 CCAGGCCTCTGGCCCTGTGCGGG - Intronic
1061618962 9:131798517-131798539 CCAGGCCACTGGGTCTGGGCAGG - Intergenic
1061762696 9:132861313-132861335 CCTAGGCACTGGCTCTGGGCTGG - Intronic
1062044564 9:134419019-134419041 CCTCTACTCTGGCTGGGGGCTGG + Intronic
1062222214 9:135422818-135422840 CCTGGGTCCTGGCTCTGGGCTGG - Intergenic
1062286222 9:135773699-135773721 CCTGGCCTTTGCCTCTGGGGTGG + Intronic
1062548371 9:137074091-137074113 CATGGACTCTGGCCTGGGGCGGG + Intergenic
1062595512 9:137297355-137297377 CCTGGTCTCTGGGTATGGCCAGG - Intergenic
1203771935 EBV:53920-53942 CCTGGACAGGGGCTTTGGGCGGG + Intergenic
1185459452 X:328143-328165 CCAGGACCCTGGGTCAGGGCGGG - Intergenic
1187501618 X:19843660-19843682 CCTGAACTCTCTCCCTGGGCAGG + Intronic
1190335266 X:49258212-49258234 CCTTTACTGTGGCACTGGGCGGG - Intronic
1190414225 X:50165803-50165825 CCTGGATTCTGTCTATGGGAAGG + Intergenic
1194480513 X:94415937-94415959 CAGGGACACTGGCTCTGAGCTGG - Intergenic
1195176279 X:102318152-102318174 CCTGTACTTAGTCTCTGGGCAGG + Intronic
1195182585 X:102368941-102368963 CCTGTACTTAGTCTCTGGGCAGG - Intronic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic
1199851379 X:151726775-151726797 GCTGGCTTCTGGATCTGGGCAGG + Intergenic
1200032377 X:153306966-153306988 CCTGGGCCCTGCCTCGGGGCGGG - Intergenic
1200243260 X:154508584-154508606 CCTGGCCCGTGGCGCTGGGCAGG + Exonic