ID: 997228941

View in Genome Browser
Species Human (GRCh38)
Location 5:132228837-132228859
Sequence AGGCTGGGCATCTCCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997228941_997228953 16 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228953 5:132228876-132228898 TGGATATTCCCTACGGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 47
997228941_997228959 29 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228959 5:132228889-132228911 CGGCACACGGGCCAGGCAGGCGG 0: 1
1: 0
2: 2
3: 14
4: 213
997228941_997228955 22 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228955 5:132228882-132228904 TTCCCTACGGCACACGGGCCAGG No data
997228941_997228958 26 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228958 5:132228886-132228908 CTACGGCACACGGGCCAGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 116
997228941_997228954 17 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228954 5:132228877-132228899 GGATATTCCCTACGGCACACGGG 0: 1
1: 0
2: 0
3: 1
4: 29
997228941_997228951 9 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228951 5:132228869-132228891 CCCAGTGTGGATATTCCCTACGG 0: 1
1: 0
2: 0
3: 12
4: 167
997228941_997228945 -4 Left 997228941 5:132228837-132228859 CCAGAGCGGGAGATGCCCAGCCT 0: 1
1: 0
2: 0
3: 17
4: 133
Right 997228945 5:132228856-132228878 GCCTCCGCCCAGGCCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997228941 Original CRISPR AGGCTGGGCATCTCCCGCTC TGG (reversed) Intronic
901842665 1:11963907-11963929 AGGCTGGGGATCCACAGCTCTGG - Intronic
903654880 1:24943029-24943051 GGGCTGGGCGCCTTCCGCTCCGG - Intronic
904037120 1:27564919-27564941 AGGCTAGGCCTTTCCCTCTCTGG - Intronic
907528428 1:55069028-55069050 AGGCTGGGCATGTTCCTCTAGGG + Exonic
908196301 1:61749002-61749024 AGCCTGGGCAACTCCATCTCAGG - Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
921986177 1:221315481-221315503 AGGCTAGCCATCTCTCTCTCCGG - Intergenic
1064033564 10:11898558-11898580 GGGCTGGGCAGCTTCCGCTGAGG + Intergenic
1067228067 10:44388118-44388140 AGGCAGGGCATCTCCTGAGCTGG + Intergenic
1075098963 10:119492616-119492638 AGGCTGGGCTTATCCAGCTCAGG - Intergenic
1075615226 10:123885723-123885745 AGGCTTGGCATCTCCAGCAATGG - Intronic
1075856625 10:125635558-125635580 AGGCAGGGCATCTCGTGCTGGGG + Intronic
1077441662 11:2571835-2571857 GGCCTGGGAATCTCCCTCTCAGG - Intronic
1079096133 11:17511487-17511509 AGGCTGGGCCTCTCCATCTCAGG - Intronic
1080387445 11:31818295-31818317 AGGCTGGCCAGCTACCTCTCTGG + Intronic
1081364010 11:42213334-42213356 AGGCTTGGCAGCTCCCAATCAGG + Intergenic
1082787268 11:57324121-57324143 GGGCTGGGCAGCTCCAGCCCCGG + Intronic
1083949168 11:65944614-65944636 AGGCTGAGGCTCTCCCTCTCCGG - Intergenic
1084268588 11:68017382-68017404 AGGCAGGGCATCTCCTTCTCTGG + Intronic
1086492470 11:87369416-87369438 TGCCTTGGCATCTCCCCCTCTGG + Intergenic
1089163493 11:116457491-116457513 AGGCTGGGCCTGTCCTGCTGAGG + Intergenic
1089365473 11:117918580-117918602 AGCCCGGGCATCTCCGGCTCTGG - Exonic
1089365486 11:117918625-117918647 AGGCCGGGCATCTCCAGCCCAGG - Exonic
1089365489 11:117918640-117918662 AGGCCGGGCATCTCCAGGCCGGG - Exonic
1089365503 11:117918685-117918707 GGGCCGGGCATCTCCAGCCCAGG - Exonic
1089365521 11:117918745-117918767 AGGCCGGGCATCTCCAGCCCAGG - Exonic
1093785267 12:23185250-23185272 GGGCTGGGCATCTGCCGCAGAGG + Intergenic
1095954834 12:47799973-47799995 ACGCTGGGCATCTCCCAGTGGGG + Intronic
1096038619 12:48494667-48494689 AGAATGGGCATCTCAGGCTCTGG - Intronic
1101813978 12:108131008-108131030 GGGCTGGGCATCTGCCTCTGCGG + Intronic
1103568062 12:121826996-121827018 AGGATGGGGATCTCCGGCCCGGG + Intronic
1104143141 12:126007203-126007225 AGTCTGGCCATCTCTCGCTGGGG + Intergenic
1104560622 12:129840614-129840636 AGGCTGCGCAGCCCCCGCCCTGG - Intronic
1105277184 13:18943243-18943265 AGGCTGGGGTTCTCCCGCAGAGG - Intergenic
1106458467 13:29948007-29948029 AGGCTGGTCATCACCTGCTCTGG - Intergenic
1113948027 13:114055792-114055814 AGCCTGGGCACCTGCCACTCTGG - Intronic
1117600318 14:57367268-57367290 AAACTGGGCATTTCCGGCTCAGG + Intergenic
1122201168 14:100123626-100123648 AGGCTGGTCATCTCCCAATCAGG + Intronic
1122503614 14:102217975-102217997 AGGCTGGCCTTCTCCCTCTGGGG + Intronic
1125597244 15:40894838-40894860 AGCGTGGGCATCCCCCACTCGGG + Exonic
1125674309 15:41494222-41494244 AGGCAGTCCCTCTCCCGCTCCGG - Exonic
1127795686 15:62436453-62436475 AGGCTGGCAAACTCCCACTCAGG - Intronic
1127848894 15:62896276-62896298 AGGCTAGGCTTCTCTTGCTCTGG + Intergenic
1129266852 15:74397754-74397776 AGGCTGGGCATCTGTAGATCAGG + Intergenic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1133261957 16:4556674-4556696 AGGCTGGGCGTCTCCTTCCCTGG - Exonic
1136071662 16:27791232-27791254 AGGCCTGGCATCTCCCACGCAGG + Exonic
1136129052 16:28207768-28207790 GGTCTGTCCATCTCCCGCTCTGG + Intronic
1136556692 16:31011182-31011204 AGCCTGGGCCTCTCCCGCCGCGG + Intergenic
1137505309 16:49049386-49049408 AGGCTGGGCAGCGCCCCCTCTGG + Intergenic
1140262327 16:73391089-73391111 AGGCTGTGCCTCCCACGCTCAGG - Intergenic
1140477712 16:75247276-75247298 AGGCTGGGGCTCTCCTCCTCTGG - Intronic
1142176272 16:88646867-88646889 CGGCTGGGCCTCTCCCACTCGGG + Intronic
1142867315 17:2798697-2798719 AGGCTGGGCCTTTCCCTTTCAGG - Intronic
1146401390 17:32502849-32502871 AGGCAGGGCGTCTCCCTCTGAGG + Intronic
1149685252 17:58531388-58531410 GGGCTGGGCCTCCCCCTCTCTGG + Intronic
1150784155 17:68149561-68149583 AGACTGGACATCTACCGCCCTGG - Intergenic
1152934087 17:83125942-83125964 AAGCTGGGCTCCACCCGCTCAGG - Intergenic
1153405505 18:4734300-4734322 GTGCTGGGCATCTCCCTGTCAGG - Intergenic
1156454359 18:37284647-37284669 GGGCAGGGCATCTCAAGCTCGGG - Intronic
1157496376 18:48160475-48160497 GGGCAGGTCATCTCCCGCTCTGG + Intronic
1163814089 19:19453157-19453179 AGGCTGGGCTTATGCCCCTCAGG + Intronic
1166364944 19:42273596-42273618 TCGCTGGGCAGCTCGCGCTCAGG + Intronic
1166632959 19:44423977-44423999 AGGCTGGGCACCTTCCTATCAGG + Intronic
1167017562 19:46850807-46850829 CGACTGGGCAGCTCCGGCTCAGG + Exonic
929779197 2:44946871-44946893 TGGCCGTGCATCTGCCGCTCTGG + Intergenic
929919910 2:46164584-46164606 AGGCAGGGCACCCCCCGCCCCGG - Intronic
932751529 2:74374523-74374545 AGGCTGGGAAGCTGCCGCACCGG - Intronic
932761631 2:74441917-74441939 CGGCCGGGAATCTCCCGCTGCGG + Intronic
933985093 2:87584289-87584311 AGGCTGGGCTTCTCGGGCGCTGG - Intergenic
934852649 2:97711275-97711297 AGGCTGGGAATCCCCTTCTCAGG + Intergenic
936059146 2:109283218-109283240 AGCCTGGCAGTCTCCCGCTCTGG + Intronic
936308751 2:111366522-111366544 AGGCTGGGCTTCTCGGGCGCGGG + Intergenic
937224338 2:120359681-120359703 AGGCTGGGCTTCTGCCGGCCTGG + Intergenic
938089151 2:128419400-128419422 AGGCTGGGCACCGCCCCGTCCGG - Intergenic
947525821 2:230876166-230876188 AGACAGGGCATCTCTCGCTGGGG + Intronic
948208920 2:236178277-236178299 AGGCAGCGCCTCTCCCGCCCCGG - Intergenic
948566393 2:238889974-238889996 AGGCTGGGCAGCCTCCGCACAGG - Intronic
948777513 2:240297346-240297368 GGGCTTGGCATCTGCCCCTCAGG + Intergenic
1172110706 20:32543265-32543287 AGGCTGGGTATCACCCTTTCTGG - Intronic
1172773594 20:37395220-37395242 AGGCTGGCCACTTCCCTCTCTGG + Intronic
1172778114 20:37419934-37419956 AGGGTGGGAACCTCCAGCTCTGG - Intergenic
1172846005 20:37930387-37930409 GGGCTGGGAATCTGCCCCTCTGG + Intronic
1173966051 20:47113706-47113728 ATGCTGGGCATTTCTCTCTCTGG - Intronic
1175313196 20:58025881-58025903 AGGCTGGGCATGTATGGCTCAGG + Intergenic
1179561905 21:42220599-42220621 AGCCTGCGGGTCTCCCGCTCGGG - Intronic
1180993628 22:19953666-19953688 AGGCTGGCCATCTGCCCCGCTGG - Intronic
1182020274 22:27075894-27075916 AGGCAGGTCACCTCCCTCTCTGG - Intergenic
1182141809 22:27966246-27966268 AGGCTGGGCACCGCCAGCTGTGG + Intergenic
1182621728 22:31622153-31622175 CTGCTGGGCGTCTCCCGTTCTGG - Intronic
1183218041 22:36493841-36493863 AGGCTGGGCTTCCCCTCCTCGGG + Intronic
1184343843 22:43900968-43900990 AGGCTTGGCACCTCCCCCACTGG - Intergenic
951557898 3:23939017-23939039 TGGCTGGGCATTTCTGGCTCAGG - Intronic
953660851 3:44890562-44890584 AAGGTGGACATCTCCCCCTCTGG - Intronic
954291513 3:49652434-49652456 AGGCTCTCCATCTCCAGCTCAGG - Exonic
954701088 3:52451238-52451260 AGGCTGGGCATAGGCAGCTCTGG + Exonic
957866420 3:86029754-86029776 AGGCTGGGCATTTCCCTCTGAGG - Intronic
961480616 3:127177478-127177500 AGGCTGTCCATCTCCCGTTGAGG - Intergenic
967288724 3:187898648-187898670 AGGCTGGGCATTTATGGCTCGGG - Intergenic
967979411 3:195056672-195056694 AGGCTGGGGAGCTCCTGCACTGG + Intergenic
971175751 4:24280956-24280978 ATGCTGGGCTTCTCCAGCTTTGG - Intergenic
971877701 4:32326345-32326367 AAGCTGGGCAGCCCCCACTCGGG + Intergenic
972080346 4:35141722-35141744 AACCTGGGCATTTCCAGCTCAGG + Intergenic
976977791 4:91185575-91185597 AACCTGGGCATTTCCAGCTCAGG - Intronic
982668840 4:158296716-158296738 AGGCTGAGCAAATCCTGCTCTGG + Intergenic
984702669 4:182828185-182828207 AGGCTGGGCAGCTCCTTCTCAGG + Intergenic
984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG + Intergenic
985672169 5:1212645-1212667 AGGCAGGGCCCCTCCCGCCCAGG - Intronic
985957278 5:3275085-3275107 AGGCTGGGCCTGTCCTGCCCTGG + Intergenic
986152399 5:5139969-5139991 ATGCTGAGCATCGCCCGCGCCGG + Intergenic
986307799 5:6528661-6528683 CGGCTGGGCATCCCCCACCCTGG + Intergenic
989235801 5:39147349-39147371 AGGCTGGACCTCTCAGGCTCGGG + Intronic
990316716 5:54589730-54589752 TGACTGGGCATTTCCCCCTCTGG - Intergenic
993726934 5:91380155-91380177 AGGCCGGTCCTCTCCTGCTCCGG - Intronic
996319728 5:122201323-122201345 AGGATGGGAATCTCGAGCTCAGG - Intergenic
996403187 5:123085014-123085036 GGGCAGGGAATATCCCGCTCTGG + Intergenic
997228941 5:132228837-132228859 AGGCTGGGCATCTCCCGCTCTGG - Intronic
997347706 5:133204087-133204109 AGGCTGGGCATCTCCCTCAGAGG + Intronic
997530175 5:134577126-134577148 AGGCTGGGCCACGCCCACTCAGG + Intronic
998039651 5:138944251-138944273 AGCCTGGCCATCACCAGCTCTGG + Intergenic
1001364273 5:171121552-171121574 AGGCTTGAGATCTCCCACTCAGG + Intronic
1001580206 5:172792962-172792984 AGGCTGGGCATCTCTCCCCTTGG + Intergenic
1004322394 6:14642166-14642188 AGCCTGGGCTTTTCCCGCTGTGG + Intergenic
1005855948 6:29863586-29863608 AACCTGGGCGTCTCCAGCTCTGG + Intergenic
1006020108 6:31112737-31112759 AAGCTGGGTGTCTCCCGCCCTGG + Intergenic
1019481735 7:1270132-1270154 AGGCTGGGCGGCTCCCAGTCTGG + Intergenic
1019577816 7:1746013-1746035 AGGCCGGGCGCCTCCAGCTCTGG - Exonic
1021390638 7:20088525-20088547 AGGCTGCTCATCTCCCACTTTGG - Intergenic
1021864900 7:24945979-24946001 GGGCTGGGCAGCTCTGGCTCAGG + Intronic
1034083187 7:148299438-148299460 AGGCTGGGCAGAGCCAGCTCAGG + Intronic
1037583668 8:20261856-20261878 AGGCTGAACATCTCCGGCTGGGG - Intronic
1037656876 8:20891727-20891749 AGGCTGAGTATCACCCTCTCAGG + Intergenic
1038255549 8:25947790-25947812 AGTCTGGGCATCAACCACTCTGG + Intronic
1041018984 8:53619052-53619074 AACCTGGGCATTTCCAGCTCAGG + Intergenic
1049487946 8:142876195-142876217 AGGCTTGGCATCACCCTCTCTGG + Intronic
1049492835 8:142914218-142914240 AGGCTTGGCATCACCCTCTCTGG + Intronic
1049508697 8:143017364-143017386 AGGCAGGGCATCTTCCCCTCTGG - Intergenic
1049711116 8:144063774-144063796 AGCCTGGGCTTCTGCAGCTCCGG - Intronic
1050925308 9:11256681-11256703 AGGCTGAGCAAATCCTGCTCCGG - Intergenic
1057192316 9:93094994-93095016 AGGCCTGGCATTTCCAGCTCCGG - Intergenic
1057210412 9:93198245-93198267 AGGCGGGGCAGTTCCAGCTCAGG - Intronic
1059825939 9:118029212-118029234 AGGCTGGGCATCCCACATTCTGG + Intergenic
1060982689 9:127802873-127802895 GGGCGGGGCGTCTCCCGCCCGGG + Exonic
1062432286 9:136531580-136531602 AGGCTGGGTCTCTCTCGCCCAGG - Intronic
1062537727 9:137028218-137028240 CCGCTGGGCATCGCCCGCGCGGG + Intronic
1188132411 X:26453218-26453240 GTGCTGGGCAGCTCCCACTCAGG - Intergenic
1188239875 X:27772875-27772897 AGGCTGGGCATCCCAGGCTGAGG + Intergenic
1195613532 X:106895095-106895117 TGGCTGGGCATGTCTCACTCTGG - Intronic
1195726933 X:107927440-107927462 AGGCTGACCACCCCCCGCTCTGG - Intergenic
1198953935 X:142106158-142106180 AGGCTGTGCATGTCCTGCTTAGG - Intergenic
1200045782 X:153400603-153400625 AGGCAGGGCACCCTCCGCTCTGG + Intergenic