ID: 997228942

View in Genome Browser
Species Human (GRCh38)
Location 5:132228846-132228868
Sequence GAGATGCCCAGCCTCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997228942 Original CRISPR GAGATGCCCAGCCTCCGCCC AGG Intronic
901687046 1:10948731-10948753 GAGGTCCCCAGCCTCCCCCAGGG - Exonic
902414837 1:16232445-16232467 CAGGGGCCCAGCCTCTGCCCAGG - Intronic
903263534 1:22143412-22143434 CAGCTGCCCGGCCGCCGCCCGGG + Intronic
903772669 1:25773828-25773850 CAGAGGCCCAGCCTTCACCCAGG - Intronic
905884460 1:41484362-41484384 GAGGTGCCCAGGCTCCCCACGGG - Intronic
905886493 1:41494729-41494751 GAGATCCACAGCCCCAGCCCTGG - Intergenic
908302426 1:62775349-62775371 GAGATGACCACCCTCCCCTCTGG + Intergenic
908844061 1:68306741-68306763 GAGGTGCCCACCCTATGCCCAGG - Intergenic
909659790 1:78069136-78069158 GAGATACCCAGGCACTGCCCTGG - Intronic
913340624 1:117754422-117754444 TTAATGCCCAGCCTCAGCCCCGG - Intergenic
914250500 1:145918227-145918249 GAACTCCCCTGCCTCCGCCCTGG - Intronic
917972395 1:180217206-180217228 CAGATGCTAAGCCTGCGCCCTGG + Intergenic
919682473 1:200449678-200449700 GGTATGCCCTGCCTCCACCCCGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922478308 1:225921954-225921976 GAGCTGCCCATCCTCCACCAGGG + Exonic
922528993 1:226328634-226328656 GAGGTATCCAGCCTCCTCCCAGG + Intergenic
923019255 1:230150158-230150180 GACATGCACTGGCTCCGCCCTGG + Intronic
924816754 1:247448658-247448680 GAGATGCCCAAGCTCTGCACAGG - Exonic
1063455324 10:6178668-6178690 GAGATGCCCACCCTGGCCCCGGG - Intronic
1063898373 10:10705946-10705968 GTCAGGCCCAGCCTCCACCCTGG + Intergenic
1066093936 10:32055606-32055628 GAAGCGCCCAGCCTCAGCCCTGG - Intronic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1069715803 10:70520461-70520483 GAGATGCCCATTCTGGGCCCTGG - Intronic
1070673451 10:78394604-78394626 GACAAGCCCAGCTTCTGCCCAGG + Intergenic
1070891332 10:79943999-79944021 GAGGTGCCCCTCCTCCACCCTGG - Intronic
1071986220 10:91053534-91053556 GAGGTGCCCAGCCTGCTCCTGGG + Intergenic
1073025491 10:100484314-100484336 GAGCTGCCCAGCCCCAGACCTGG - Intergenic
1074889106 10:117720482-117720504 GAGTTGCCCAGACTCAGCCTGGG - Intergenic
1075578122 10:123595761-123595783 GCTATGCCCAGCCTCCTACCTGG - Intergenic
1076008656 10:126968770-126968792 GGGAAGTCCAGCCTCTGCCCTGG + Intronic
1076321753 10:129588210-129588232 GAGACTCGCAGCCTCAGCCCTGG + Intronic
1076754679 10:132563052-132563074 GAGGTGCCATGCCCCCGCCCAGG + Intronic
1076761468 10:132608065-132608087 GAGAGACCCAGCCACAGCCCAGG - Intronic
1076878791 10:133230234-133230256 GAGAGGGCCAGACGCCGCCCGGG - Intergenic
1077488626 11:2850408-2850430 GCCAGGCCCAGCCTCCGCCATGG - Intergenic
1077503438 11:2919486-2919508 GGGCTCCCCAGCCTCCGCCGGGG - Intronic
1078015504 11:7610113-7610135 GAGTAGCCCAGCATCAGCCCAGG + Intronic
1078510056 11:11978287-11978309 GTGCTTCCCAGCCTCCTCCCTGG - Intronic
1083490365 11:63011034-63011056 GAGAGGCACAGTCTCTGCCCTGG + Intronic
1083693953 11:64430196-64430218 CAGAAGCCCAGGCTCAGCCCCGG - Intergenic
1084562953 11:69914410-69914432 AAGATGCCCAGCCCCCTCCCTGG - Intergenic
1084573624 11:69975137-69975159 GAGAGGCTCAGCCTCTGACCCGG - Intergenic
1089560331 11:119340309-119340331 AAGATCCCCAGCCTCTGCCCGGG - Exonic
1089650155 11:119907636-119907658 CAGATGCCCATCCTGGGCCCAGG - Intergenic
1089842123 11:121427379-121427401 GAGCTGCGCAGCCGCCGCGCCGG + Intergenic
1090731196 11:129574456-129574478 GAGCTGACCAGCCTCCAGCCAGG + Intergenic
1090815927 11:130295538-130295560 GAGGTGCCCAGCCTGCCCCTGGG + Intronic
1091030616 11:132184272-132184294 TGGATCCCCAGCCTCAGCCCGGG - Intronic
1091381858 12:67061-67083 TGCAAGCCCAGCCTCCGCCCGGG + Exonic
1094373116 12:29759711-29759733 GATTTCCCCAGCCTCAGCCCTGG - Intronic
1095976067 12:47941961-47941983 CAGAGGCCCAGCCCCCGCTCGGG + Intronic
1096116947 12:49060391-49060413 GAGCTGCCCCGCCCCCGGCCTGG + Intergenic
1096634353 12:52949060-52949082 GTGAGGCCCCGCCCCCGCCCCGG - Exonic
1096640477 12:52990420-52990442 GAAAAGCCCAGCGTCCGCTCCGG + Intergenic
1101400099 12:104379647-104379669 GAAATGCCCAGCCCCAGGCCGGG - Intergenic
1102466847 12:113135172-113135194 CAGATGCCCCGCCTCACCCCCGG - Intronic
1102534425 12:113570050-113570072 CAGCTGCCCAGCCTGGGCCCCGG - Intergenic
1102557472 12:113736948-113736970 GAGATTCCCAGCCTCTCCCAGGG - Intergenic
1103922635 12:124407068-124407090 CAGGTGCCCTACCTCCGCCCTGG + Intronic
1104040833 12:125129483-125129505 GAGCTGGCCAGCCTCTGCCTTGG + Intronic
1104623235 12:130333751-130333773 GAGCTGCCCAGCCTCTCCCCTGG - Intergenic
1104919642 12:132283794-132283816 GAGATGCCCAGGCAGGGCCCAGG - Intronic
1104970457 12:132528468-132528490 GTGTTGCCCAGCCTGGGCCCAGG - Intronic
1105277186 13:18943252-18943274 GAGAACCCCAGCCTCCTCCTGGG + Intergenic
1106458741 13:29949582-29949604 GAGATACACAGACTCCTCCCAGG - Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1110656593 13:78007393-78007415 GAGATTCCCAGCTCCCGTCCAGG + Intergenic
1112042198 13:95557752-95557774 GAGATGCCCCGTCCCAGCCCTGG - Intronic
1113549017 13:111177240-111177262 AACAGGCCCAGCCTCAGCCCCGG - Intronic
1114007045 14:18325095-18325117 TTGAATCCCAGCCTCCGCCCTGG - Intergenic
1114294810 14:21319593-21319615 GAAATGCCCATCCTCCATCCAGG + Intronic
1118137492 14:63045561-63045583 GAGATGCAGAGCCCGCGCCCAGG - Intronic
1118790161 14:69083863-69083885 GAGATGCCCAGCCTGCCCCTGGG + Intronic
1121722562 14:96120597-96120619 GTGATGCTCAGCCTCAGCCTGGG - Intergenic
1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG + Intergenic
1123390963 15:19871740-19871762 TCGAATCCCAGCCTCCGCCCTGG - Intergenic
1124202516 15:27690609-27690631 CAAATGCCCAGCCTCTGCCTGGG + Intergenic
1125004211 15:34799581-34799603 GAGCGGCCCAGCCTCCTCCCCGG + Intergenic
1125519585 15:40340440-40340462 GAGAGGCCCTGGCTCCGTCCTGG + Intronic
1131186037 15:90275046-90275068 GCGACTCCCAGCCGCCGCCCGGG + Exonic
1131199634 15:90386005-90386027 GACATGCCCAGCCACCCCCAAGG + Intergenic
1132117677 15:99149508-99149530 GTGATTCTCAGCCTCCGCCTGGG + Intronic
1132393753 15:101457456-101457478 CAGCTGACCAGCCTGCGCCCTGG - Intronic
1132395727 15:101472631-101472653 GAGCTGCTCAGCCTCCTCCCTGG - Intronic
1132709565 16:1260330-1260352 GAGAGGCCCAGCCTCCGCATGGG - Intergenic
1136923112 16:34347145-34347167 GAGAGGCACAGCCTCTGCCTGGG - Intergenic
1136981461 16:35064661-35064683 GAGAGGCACAGCCTCTGCCTGGG + Intergenic
1138341691 16:56293812-56293834 CAGATGCCCAGCCGCCTCACCGG + Intronic
1138541290 16:57689238-57689260 GCAATGCCCAGCCTCTGCTCAGG - Exonic
1141419968 16:83908122-83908144 AGGATGCACAGCCTCAGCCCTGG - Exonic
1141443415 16:84043475-84043497 CAGGTGCCCAGACCCCGCCCCGG - Intergenic
1141566699 16:84907215-84907237 GAGAGACCCCGGCTCCGCCCTGG + Exonic
1143810705 17:9469121-9469143 GAGCTGCCCAGCCTTCTCCTAGG - Intronic
1143942977 17:10562188-10562210 GAGATGCCTAGCCACCCACCTGG + Intergenic
1146581145 17:34039971-34039993 GAGAGGCCCCGGCTCCGCCCCGG - Intronic
1146894648 17:36532793-36532815 GACAGGCCCACTCTCCGCCCAGG - Intronic
1147171206 17:38620126-38620148 CAGCTGCCCAGCCCCCGTCCAGG + Intergenic
1148163910 17:45469010-45469032 GAGATGCCAGGACTCTGCCCTGG + Intronic
1148461399 17:47840993-47841015 GAGGTGCCCACCCTCTCCCCAGG + Intronic
1148624164 17:49056183-49056205 GAGATGCTCAGCCTCAGCATGGG + Intergenic
1149461392 17:56833157-56833179 GAGAGGCACAGGCACCGCCCCGG - Exonic
1150108620 17:62479175-62479197 GAGAGGCCCCGGCTCCGCCCCGG + Exonic
1150210320 17:63438087-63438109 GAGGGGCCCAGCCTCCCCACGGG + Intronic
1150488282 17:65559068-65559090 GAGCTGCCCTGCGTGCGCCCTGG - Intronic
1151679862 17:75617478-75617500 AAGATGCCCAGGCCCTGCCCTGG - Intergenic
1151948373 17:77331739-77331761 CAGATGACCAGCCCCCGCACAGG + Intronic
1152646862 17:81473217-81473239 CAGATGCCCAGGCACTGCCCAGG - Intergenic
1153344050 18:4007191-4007213 AAGAAGCCCTGCCTCTGCCCTGG - Intronic
1157681578 18:49611668-49611690 AAGATGCCCAGCCCCACCCCAGG - Intergenic
1159601199 18:70430368-70430390 GAGCTCCGCAGCCTCGGCCCTGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160869718 19:1271670-1271692 GGGATGGCCAGCTTCCGTCCCGG + Intronic
1162068180 19:8138155-8138177 GGGATCCCCAGCCTGGGCCCTGG - Exonic
1162743863 19:12788609-12788631 GGCATGGCCAGCCTCAGCCCTGG + Intronic
1163371479 19:16903604-16903626 CAGATCCCCAGCCTCCCCACGGG - Exonic
1163422081 19:17219403-17219425 GAGCTCTCCAGCCTCTGCCCTGG + Intronic
1163604094 19:18264809-18264831 GAGCTGCCCAGACTTCTCCCTGG + Exonic
1163948333 19:20561363-20561385 GACATGTCCACCCTCCTCCCAGG - Intronic
1164159675 19:22618100-22618122 GGGACGCCCTGCCTCCGGCCCGG - Intergenic
1164937344 19:32224562-32224584 CAGTTGCCCCGCCGCCGCCCGGG - Intergenic
1165742265 19:38211301-38211323 GAGAAGCACAGACTCCGCCACGG - Intronic
1166079363 19:40434065-40434087 CCGCTGCCCACCCTCCGCCCTGG - Intergenic
1166813336 19:45527080-45527102 GAGAACCCCTGCCTCCTCCCAGG + Intergenic
926213636 2:10890082-10890104 GATTTGCCCAGCCTCCGGCGTGG - Intergenic
927138911 2:20116398-20116420 ATGATGCCCATCCTCCTCCCAGG + Intergenic
927201716 2:20582413-20582435 GAGAGGCCCACCCTCCCCCTAGG - Intronic
930023465 2:47015184-47015206 GGCATGCCCAGCCTCCTGCCAGG + Intronic
931195886 2:60052114-60052136 GAGAGGCCAAGACTCTGCCCTGG + Intergenic
931727084 2:65121791-65121813 AAAATGCCCAGACTCCCCCCCGG - Intronic
932447541 2:71790228-71790250 GAGATGGACACCCTCTGCCCTGG - Intergenic
934737227 2:96695672-96695694 GGGCTGCCCAGCCCCTGCCCTGG - Intergenic
935194553 2:100804710-100804732 GTGTTGCCCAGGCTCTGCCCTGG - Intergenic
936514493 2:113173344-113173366 GAGATGCTAAGCCACTGCCCAGG - Intronic
938319237 2:130352029-130352051 CAGATGCCCAGGCTCTGCCCTGG + Intergenic
938340034 2:130529711-130529733 GAGATGCCCTCCCTCCATCCGGG - Intergenic
938349801 2:130591037-130591059 GAGATGCCCTCCCTCCATCCGGG + Intergenic
940047967 2:149429788-149429810 GAGCTGCCCAGCCAACCCCCAGG - Intronic
946727274 2:222672860-222672882 CAGATGCCCAGGCTCCATCCTGG + Intronic
948040324 2:234896411-234896433 GAGATGCCCGGCCTGCCACCTGG + Intergenic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948374430 2:237512127-237512149 CAGAAGCACAGCCTCTGCCCTGG - Intronic
948648919 2:239426682-239426704 GAGGTGCCCATCCTGAGCCCAGG - Intergenic
948684779 2:239663647-239663669 GGGATGACCTGCCCCCGCCCAGG - Intergenic
948720693 2:239898325-239898347 GAGGTGCTCAGCCTGCGCCCGGG + Intronic
948757224 2:240166804-240166826 GTGATGCCAAGCCTCCTCCTGGG + Intergenic
1171191758 20:23163955-23163977 AAGATGCCCAGGCTGCACCCCGG - Intergenic
1172304261 20:33870417-33870439 CAGTGGCCCAGCCTCTGCCCTGG + Intergenic
1173589112 20:44210547-44210569 GAGAGGCCCAGGCCCGGCCCAGG + Intronic
1174084706 20:47998723-47998745 GAGAAGCCGAGCATCCTCCCTGG - Intergenic
1174441613 20:50560099-50560121 GAGATGCTCTGCCTCCTACCTGG + Intronic
1174909890 20:54595972-54595994 GAGAAGCCCAGCATCCTTCCAGG - Intronic
1175389842 20:58620183-58620205 GAAATGCCAAGCCTCCTCCTGGG + Intergenic
1176283344 20:64327772-64327794 TGCAAGCCCAGCCTCCGCCCGGG - Intergenic
1178790248 21:35693185-35693207 CAGATGCCCAGACTCAGCCAGGG - Intronic
1179153736 21:38831703-38831725 CACATGTCCAGACTCCGCCCAGG - Intergenic
1180431553 22:15255905-15255927 TTGAATCCCAGCCTCCGCCCTGG - Intergenic
1180514112 22:16123817-16123839 TTGAATCCCAGCCTCCGCCCTGG - Intergenic
1180626045 22:17194245-17194267 GAAATGCCCTTCCTCCTCCCGGG + Intronic
1181518793 22:23433651-23433673 GAGCTGGGCAGCCTCAGCCCAGG + Intergenic
1181567904 22:23750980-23751002 GAGCTGCCCCGCCCCGGCCCAGG - Exonic
1182235457 22:28872304-28872326 GAGGTGCCCAGCCTCCTACACGG - Intergenic
1183084485 22:35478194-35478216 GAGCTGGCCGGCCTCCGCCTTGG + Intergenic
1183287035 22:36973288-36973310 GAGATGCCCAGCCCCTCCCTTGG - Intergenic
1183600280 22:38835923-38835945 GAGACGCCCCCCCGCCGCCCCGG + Intronic
1183683376 22:39348084-39348106 AAGATGCCCAGCATCCGCGGTGG - Intergenic
1184059663 22:42074273-42074295 GAGATCCCGCGCCTCCGCCTGGG - Exonic
1184568972 22:45310238-45310260 GAGATCCTCAGGATCCGCCCCGG + Intronic
1184572083 22:45331765-45331787 GAGAGGCTCAGTCTCAGCCCAGG - Intronic
1184610240 22:45598810-45598832 CAGATGCCCAGCATCTGCCAAGG - Intronic
1184749637 22:46477929-46477951 GTGCTGCCCAGCATCCTCCCGGG - Intronic
1184954643 22:47877680-47877702 GAGATGCCCGTCCTCTGGCCGGG + Intergenic
1185266468 22:49906770-49906792 GAGCTGGCCAGCCTCAGCCCTGG + Intronic
952303069 3:32121371-32121393 AAGGTACCCAGCCTCCTCCCCGG + Intronic
953033577 3:39193009-39193031 GAGGTGCCCAGCCTGCCCTCAGG - Intergenic
953197698 3:40750025-40750047 GAGCTGCCCAACCTCCACCCAGG - Intergenic
953891752 3:46756268-46756290 TAGATAACCCGCCTCCGCCCTGG - Exonic
953923053 3:46965515-46965537 GAGAGGCTCACCCTTCGCCCAGG + Intronic
954121967 3:48504741-48504763 GTGATCCCCAGCCCCAGCCCTGG + Intronic
954200603 3:49021285-49021307 GAGATGCCCAAACCCCGCGCGGG + Exonic
954624740 3:52016290-52016312 GAGAGGCCCAGCCTCCACCATGG - Intergenic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
954907179 3:54072756-54072778 GAGGAGCCAAGCCTCCGACCTGG + Intergenic
959605740 3:108239785-108239807 CAGATGCCCATCCTCCACCATGG + Intergenic
960385708 3:117019410-117019432 CAGATGCCTAGCCTCTACCCTGG - Intronic
961331803 3:126147020-126147042 GAGAAGCCCAGCCTGGCCCCAGG - Intronic
961334216 3:126160581-126160603 GAGAAGCCCAGCCTGGTCCCAGG - Intronic
961386312 3:126525150-126525172 GAGGGGCCCAGCCAGCGCCCGGG + Intronic
961414806 3:126749472-126749494 GAGATGCCTAGACTCCTCTCTGG + Intronic
961654996 3:128436254-128436276 GACATGGCCAGCCTCAACCCAGG - Intergenic
961668240 3:128507350-128507372 GACATGCCCACTCTCTGCCCTGG - Intergenic
963363427 3:144304757-144304779 AAGATGCCCAGTCTCAGCTCTGG - Intergenic
968444826 4:646685-646707 GACACGCGCAGCCTCCGGCCGGG + Intronic
968572175 4:1347512-1347534 CAGCTTCCCAGCCTCCGCCCCGG + Exonic
969320354 4:6408671-6408693 CAGATTCCCAGGCCCCGCCCAGG - Intronic
970602354 4:17650444-17650466 GAGAAGCCCAGCCTTTCCCCAGG + Intronic
975794927 4:77997037-77997059 CTGATGACCAGCCTCCACCCAGG + Intergenic
982420845 4:155195410-155195432 TAGATTCCCAGACTCTGCCCCGG - Intergenic
992089358 5:73303649-73303671 GAGATGCGCGGCGTCCGCGCGGG + Intergenic
994345416 5:98679880-98679902 GAGGTGCCCAGCCTGCCCCTGGG + Intergenic
994589739 5:101758683-101758705 GAGGTGCCCAGCATGCGCACAGG - Intergenic
997228942 5:132228846-132228868 GAGATGCCCAGCCTCCGCCCAGG + Intronic
997236627 5:132275731-132275753 GTCCTGCCCAGCCTCCACCCAGG + Intronic
1001645512 5:173278819-173278841 GAGAAGCCCAGCGTCCACCCAGG - Intergenic
1001924002 5:175622975-175622997 GAGGGCCCCAGCCTCAGCCCAGG - Intergenic
1002440062 5:179259575-179259597 GTGAATCCCAGCCTCTGCCCTGG - Intronic
1002549406 5:179975945-179975967 CATATGCCCGGCCTCCACCCGGG + Intronic
1004168179 6:13275145-13275167 GAGATGCCATGGCTCAGCCCTGG + Intronic
1004731601 6:18364918-18364940 GAGGTGCCCAGCCTGCCCCTGGG - Intergenic
1005030098 6:21500612-21500634 GAGCTCCCCACCCACCGCCCAGG + Intergenic
1006930974 6:37688286-37688308 CAGATGCCCAGCCCCACCCCGGG - Intronic
1016616279 6:146052389-146052411 TAGATGCCCAGCCCCAGCCGTGG + Intronic
1017814014 6:158003941-158003963 GAGTTCCCCAGCCTCCTCCAAGG + Intronic
1019599766 7:1875290-1875312 GAGCTGGGCAGCCTCAGCCCAGG - Intronic
1020098656 7:5382322-5382344 CAGAGGCCCAGCCCCAGCCCAGG + Intronic
1020621767 7:10527840-10527862 GTGCTGCCCTTCCTCCGCCCAGG - Intergenic
1027229747 7:76265277-76265299 AAGTTGCCCAGCCTCCCACCAGG - Intronic
1028193428 7:87877097-87877119 CATATGCTAAGCCTCCGCCCGGG + Intronic
1028484337 7:91341621-91341643 GTGATAACCAGCCTCCACCCAGG - Intergenic
1029422230 7:100477632-100477654 GAGCTGGCCAGCCTCGGCCTGGG - Exonic
1029509643 7:100985941-100985963 GAGATGCCCCACCTCCACCTTGG + Intronic
1029679927 7:102101372-102101394 GAGACACCCAGCATCTGCCCGGG + Intronic
1032037639 7:128531691-128531713 GGGAGGCCCCGGCTCCGCCCCGG + Intergenic
1033407833 7:141088009-141088031 GAGATGCCCAGATGCAGCCCTGG + Intronic
1033791379 7:144795944-144795966 CAGCTGCACAGCCTCCACCCAGG + Intronic
1034159329 7:148981341-148981363 GAGAAGATCAGCCTCCGGCCAGG + Intergenic
1035047088 7:155974627-155974649 GAGACGCCCAGCCACTGCCCAGG - Intergenic
1035052119 7:156005009-156005031 GCGAGGCCAAGCCTGCGCCCCGG - Intergenic
1035208995 7:157313984-157314006 GAGATGCTCAGCCTTCGGCGTGG - Intergenic
1037662775 8:20941624-20941646 GAGATGAACAGCCTCAGCTCTGG + Intergenic
1038020012 8:23544891-23544913 GAGAAGCCCAGCCTCCTCCCAGG + Intronic
1040387413 8:46922821-46922843 GAGATGCCCATACTCCCCCAGGG + Intergenic
1048277073 8:133074700-133074722 GAGAAGCCCAGCCCCCAACCTGG - Intronic
1048865799 8:138760707-138760729 GAGCTGCCCAGACTCTGGCCAGG + Intronic
1049324478 8:142014910-142014932 GGGCTGCCCAGCCTCTCCCCAGG + Intergenic
1049475617 8:142795745-142795767 CAGATGCCCAGCCTCCCCTGCGG - Intergenic
1049606700 8:143532918-143532940 GAGAGGCCGAGCCTGCGTCCTGG - Intronic
1049657085 8:143803720-143803742 CTGATGCCCAGCCTCTCCCCAGG + Exonic
1049967910 9:796015-796037 GAGGGGCCCACCCTCCACCCAGG - Intergenic
1053708131 9:40776646-40776668 TTGAATCCCAGCCTCCGCCCTGG + Intergenic
1054418041 9:64897432-64897454 TTGAATCCCAGCCTCCGCCCTGG + Intergenic
1056946566 9:91002678-91002700 GGGAGGCCCAGCTTCAGCCCTGG + Intergenic
1057725064 9:97562538-97562560 GAAATCCCCAGCCCCAGCCCAGG - Intronic
1057873008 9:98732250-98732272 AAGTTGTCCAGCCTCCGGCCTGG + Exonic
1058977530 9:110138307-110138329 GAGAAGCACAGCCTCCCTCCTGG + Exonic
1059403461 9:114085375-114085397 GAGATGTCCTGCCTCCACCCAGG + Intergenic
1059702621 9:116790401-116790423 GGAATGTCCATCCTCCGCCCTGG + Intronic
1060478308 9:124000967-124000989 CAGCTGCCCAGCCGCAGCCCAGG + Intergenic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1190495600 X:51025741-51025763 GAGAAGCACAGCATCAGCCCGGG + Intergenic
1190510326 X:51167840-51167862 GAGAAGCACAGCATCAGCCCGGG - Intergenic
1194023168 X:88719408-88719430 AAGATGCCCAGTCTTCACCCTGG + Intergenic
1195038281 X:100990180-100990202 GAGGTGCCCATCCTCTGCCCTGG - Intronic
1199982635 X:152929258-152929280 GAGGGGCTCAGCCTCTGCCCTGG + Intronic