ID: 997231288

View in Genome Browser
Species Human (GRCh38)
Location 5:132245220-132245242
Sequence CATTGTTACTTGAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997231288_997231292 -6 Left 997231288 5:132245220-132245242 CCCTATTCCCTCAAGTAACAATG 0: 1
1: 1
2: 0
3: 9
4: 143
Right 997231292 5:132245237-132245259 ACAATGTGTGAAATGCCCCTAGG 0: 1
1: 0
2: 1
3: 12
4: 159
997231288_997231294 7 Left 997231288 5:132245220-132245242 CCCTATTCCCTCAAGTAACAATG 0: 1
1: 1
2: 0
3: 9
4: 143
Right 997231294 5:132245250-132245272 TGCCCCTAGGGAAAAAGCAAAGG 0: 1
1: 0
2: 6
3: 25
4: 213
997231288_997231298 16 Left 997231288 5:132245220-132245242 CCCTATTCCCTCAAGTAACAATG 0: 1
1: 1
2: 0
3: 9
4: 143
Right 997231298 5:132245259-132245281 GGAAAAAGCAAAGGTAAATGTGG No data
997231288_997231293 -5 Left 997231288 5:132245220-132245242 CCCTATTCCCTCAAGTAACAATG 0: 1
1: 1
2: 0
3: 9
4: 143
Right 997231293 5:132245238-132245260 CAATGTGTGAAATGCCCCTAGGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997231288 Original CRISPR CATTGTTACTTGAGGGAATA GGG (reversed) Intronic
902145268 1:14393496-14393518 CCTTGATATTTGAAGGAATACGG - Intergenic
902145268 1:14393496-14393518 CCTTGATATTTGAAGGAATACGG - Intergenic
902517885 1:16999592-16999614 GATTGTTGCTTGAGAGAAAAAGG + Intronic
902517885 1:16999592-16999614 GATTGTTGCTTGAGAGAAAAAGG + Intronic
904220598 1:28965427-28965449 TATTATTACTTAAGAGAATAAGG + Intronic
904220598 1:28965427-28965449 TATTATTACTTAAGAGAATAAGG + Intronic
908335100 1:63114597-63114619 CATCTTTACTTCAAGGAATAGGG + Intergenic
908335100 1:63114597-63114619 CATCTTTACTTCAAGGAATAGGG + Intergenic
909030465 1:70533565-70533587 CATTCCTACTTGAGGAACTAAGG - Intergenic
909030465 1:70533565-70533587 CATTCCTACTTGAGGAACTAAGG - Intergenic
911181510 1:94864731-94864753 CATTTTTACTTCTGGAAATAGGG - Exonic
911181510 1:94864731-94864753 CATTTTTACTTCTGGAAATAGGG - Exonic
911699205 1:100931644-100931666 CATTGTTTCTTGTGGGAAATCGG + Intronic
911699205 1:100931644-100931666 CATTGTTTCTTGTGGGAAATCGG + Intronic
914383682 1:147146215-147146237 CATTCTCCCTTGAGGGAATGAGG - Intergenic
914383682 1:147146215-147146237 CATTCTCCCTTGAGGGAATGAGG - Intergenic
914408383 1:147400456-147400478 CACTGATACTGCAGGGAATATGG + Intergenic
914408383 1:147400456-147400478 CACTGATACTGCAGGGAATATGG + Intergenic
917388684 1:174507454-174507476 AATTGATACTATAGGGAATAGGG - Intronic
917388684 1:174507454-174507476 AATTGATACTATAGGGAATAGGG - Intronic
918370615 1:183857716-183857738 CATAATTACCTGAGGGAAAATGG + Intronic
918370615 1:183857716-183857738 CATAATTACCTGAGGGAAAATGG + Intronic
921455086 1:215361434-215361456 GATTGTTACTAGAGGGTATGGGG - Intergenic
921455086 1:215361434-215361456 GATTGTTACTAGAGGGTATGGGG - Intergenic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
924063229 1:240197677-240197699 CATTGTTGAGTGAGAGAATAGGG + Intronic
924063229 1:240197677-240197699 CATTGTTGAGTGAGAGAATAGGG + Intronic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1063087637 10:2833845-2833867 GTTTGTCACTTGAGGGAACAGGG + Intergenic
1063087637 10:2833845-2833867 GTTTGTCACTTGAGGGAACAGGG + Intergenic
1063381201 10:5587415-5587437 CATTGTTCTTTGAGGAAATTTGG + Intergenic
1063381201 10:5587415-5587437 CATTGTTCTTTGAGGAAATTTGG + Intergenic
1065269544 10:24013471-24013493 CATTGCTCCTAGAGGAAATACGG - Intronic
1065269544 10:24013471-24013493 CATTGCTCCTAGAGGAAATACGG - Intronic
1067275431 10:44829106-44829128 CATTGTCACTTAAGGCATTATGG + Intergenic
1067275431 10:44829106-44829128 CATTGTCACTTAAGGCATTATGG + Intergenic
1069318388 10:67136925-67136947 CATTTTTAGTTGAGAGAGTAGGG + Intronic
1069318388 10:67136925-67136947 CATTTTTAGTTGAGAGAGTAGGG + Intronic
1071943027 10:90609612-90609634 CATTTTTACTTGAGTGACTGAGG + Intergenic
1071943027 10:90609612-90609634 CATTTTTACTTGAGTGACTGAGG + Intergenic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1074351578 10:112742749-112742771 CATTTATACTTCAGAGAATATGG + Intronic
1074351578 10:112742749-112742771 CATTTATACTTCAGAGAATATGG + Intronic
1075619992 10:123919486-123919508 CATTCTTACTTTATGGAGTATGG - Intronic
1075619992 10:123919486-123919508 CATTCTTACTTTATGGAGTATGG - Intronic
1076119641 10:127925336-127925358 CATTCTTTCCTGAAGGAATAAGG - Intronic
1076119641 10:127925336-127925358 CATTCTTTCCTGAAGGAATAAGG - Intronic
1076304288 10:129453014-129453036 CATTGTTACTTGAAATATTATGG - Intergenic
1076304288 10:129453014-129453036 CATTGTTACTTGAAATATTATGG - Intergenic
1077825560 11:5805203-5805225 AATAGTTACTTGTGGAAATATGG + Intronic
1077825560 11:5805203-5805225 AATAGTTACTTGTGGAAATATGG + Intronic
1079469409 11:20764022-20764044 CACTGTTGCCTGTGGGAATATGG + Intronic
1079469409 11:20764022-20764044 CACTGTTGCCTGTGGGAATATGG + Intronic
1082673499 11:56066647-56066669 CTTTGTTTCTTGAGGGATTTAGG - Intergenic
1082673499 11:56066647-56066669 CTTTGTTTCTTGAGGGATTTAGG - Intergenic
1083565193 11:63708783-63708805 AATTGTTGCTTGATGGAAAAAGG - Intronic
1083565193 11:63708783-63708805 AATTGTTGCTTGATGGAAAAAGG - Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1087230870 11:95661491-95661513 TATTGTTACTCGAAAGAATATGG - Intergenic
1087230870 11:95661491-95661513 TATTGTTACTCGAAAGAATATGG - Intergenic
1088202496 11:107354426-107354448 CATTGTAAAATGAGGAAATAAGG - Intronic
1088202496 11:107354426-107354448 CATTGTAAAATGAGGAAATAAGG - Intronic
1092122519 12:6054513-6054535 CATTGTTTCTTTGGGGAAGAAGG - Intronic
1092122519 12:6054513-6054535 CATTGTTTCTTTGGGGAAGAAGG - Intronic
1093257779 12:16892591-16892613 CTTTGTTACTGTAAGGAATATGG - Intergenic
1093257779 12:16892591-16892613 CTTTGTTACTGTAAGGAATATGG - Intergenic
1094284752 12:28780468-28780490 AAATGTTACGTGAGTGAATATGG - Intergenic
1094284752 12:28780468-28780490 AAATGTTACGTGAGTGAATATGG - Intergenic
1094526458 12:31234343-31234365 CATTGTTGAGTGAGGAAATAAGG + Intergenic
1094526458 12:31234343-31234365 CATTGTTGAGTGAGGAAATAAGG + Intergenic
1097438343 12:59578175-59578197 CATTGTTATTTGAAGAACTATGG + Intergenic
1097438343 12:59578175-59578197 CATTGTTATTTGAAGAACTATGG + Intergenic
1097589785 12:61560673-61560695 CATTCTGAATTGAGGGGATAAGG + Intergenic
1097589785 12:61560673-61560695 CATTCTGAATTGAGGGGATAAGG + Intergenic
1100144181 12:91657110-91657132 CCATGTTACTTGAGGAAAAACGG + Intergenic
1100144181 12:91657110-91657132 CCATGTTACTTGAGGAAAAACGG + Intergenic
1100693306 12:97063123-97063145 CTTTGTTATTTGAGAGATTAGGG + Intergenic
1100693306 12:97063123-97063145 CTTTGTTATTTGAGAGATTAGGG + Intergenic
1100734304 12:97509969-97509991 CATTGAGATTTGAGGAAATAAGG - Intergenic
1100734304 12:97509969-97509991 CATTGAGATTTGAGGAAATAAGG - Intergenic
1102733265 12:115133729-115133751 CATTGTCATTTGAGGCAATACGG + Intergenic
1102733265 12:115133729-115133751 CATTGTCATTTGAGGCAATACGG + Intergenic
1103194342 12:119029141-119029163 CCTTCTTCCTTGAGGGAATGGGG - Intronic
1103194342 12:119029141-119029163 CCTTCTTCCTTGAGGGAATGGGG - Intronic
1104203384 12:126614008-126614030 CATAGTTACCTGTGGAAATATGG + Intergenic
1104203384 12:126614008-126614030 CATAGTTACCTGTGGAAATATGG + Intergenic
1106169744 13:27278992-27279014 CCTGGCTACTTGAGAGAATAAGG + Intergenic
1106169744 13:27278992-27279014 CCTGGCTACTTGAGAGAATAAGG + Intergenic
1109617186 13:64850918-64850940 CATTTTTACCTGAGAGAAAAGGG - Intergenic
1109617186 13:64850918-64850940 CATTTTTACCTGAGAGAAAAGGG - Intergenic
1110530943 13:76596994-76597016 CATAATTATTTGAGGAAATATGG + Intergenic
1110530943 13:76596994-76597016 CATAATTATTTGAGGAAATATGG + Intergenic
1110799538 13:79679079-79679101 CATTGTGCCTTTAGGAAATAAGG + Intergenic
1110799538 13:79679079-79679101 CATTGTGCCTTTAGGAAATAAGG + Intergenic
1111003747 13:82221166-82221188 AATTGTTACTTGCTGGAAAATGG + Intergenic
1111003747 13:82221166-82221188 AATTGTTACTTGCTGGAAAATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112119260 13:96392021-96392043 CAGTATTCCTTGAGTGAATAAGG + Intronic
1112119260 13:96392021-96392043 CAGTATTCCTTGAGTGAATAAGG + Intronic
1112133643 13:96551795-96551817 CTTTCTCACTTGAGGAAATAAGG + Intronic
1112133643 13:96551795-96551817 CTTTCTCACTTGAGGAAATAAGG + Intronic
1112242789 13:97698579-97698601 CAATCTCACTTAAGGGAATAGGG + Intergenic
1112242789 13:97698579-97698601 CAATCTCACTTAAGGGAATAGGG + Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1117806715 14:59499936-59499958 CATTCTTGCTCTAGGGAATAGGG + Intronic
1117806715 14:59499936-59499958 CATTCTTGCTCTAGGGAATAGGG + Intronic
1118103025 14:62627273-62627295 CATGGTTAATTCAGGGACTATGG + Intergenic
1118103025 14:62627273-62627295 CATGGTTAATTCAGGGACTATGG + Intergenic
1118103037 14:62627375-62627397 CATGGTTAATTCAGGGACTATGG - Intergenic
1118103037 14:62627375-62627397 CATGGTTAATTCAGGGACTATGG - Intergenic
1118991537 14:70801361-70801383 TATTGTCACTAAAGGGAATATGG + Intronic
1118991537 14:70801361-70801383 TATTGTCACTAAAGGGAATATGG + Intronic
1120678380 14:87449921-87449943 CAATGTATCTTGAGGGTATATGG + Intergenic
1120678380 14:87449921-87449943 CAATGTATCTTGAGGGTATATGG + Intergenic
1122188873 14:100023971-100023993 CATTCTTGCTTGACGGATTATGG - Intronic
1122188873 14:100023971-100023993 CATTCTTGCTTGACGGATTATGG - Intronic
1125232463 15:37472310-37472332 CATTGTTTCTTGATGAAAAATGG - Intergenic
1125232463 15:37472310-37472332 CATTGTTTCTTGATGAAAAATGG - Intergenic
1128191612 15:65705557-65705579 CATTGTTAATTTAGGGAATTTGG - Intronic
1128191612 15:65705557-65705579 CATTGTTAATTTAGGGAATTTGG - Intronic
1135747530 16:25029889-25029911 CCCTGTAACTTGAGGGAATTTGG - Intergenic
1135747530 16:25029889-25029911 CCCTGTAACTTGAGGGAATTTGG - Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1139088121 16:63613917-63613939 CATTGTTACTTGCTGGACTCTGG + Intergenic
1139088121 16:63613917-63613939 CATTGTTACTTGCTGGACTCTGG + Intergenic
1139202322 16:64990792-64990814 CATTGTTATCTGGGGGATTATGG - Intronic
1139202322 16:64990792-64990814 CATTGTTATCTGGGGGATTATGG - Intronic
1140871346 16:79109427-79109449 CTTTTTTACTTTAGGGCATAGGG + Intronic
1140871346 16:79109427-79109449 CTTTTTTACTTTAGGGCATAGGG + Intronic
1147110106 17:38256227-38256249 CACTGTCACTTGAGGGAAAGGGG + Intergenic
1147110106 17:38256227-38256249 CACTGTCACTTGAGGGAAAGGGG + Intergenic
1148419407 17:47532194-47532216 CACTGTCACTTGAGGGAAAGGGG - Intronic
1148419407 17:47532194-47532216 CACTGTCACTTGAGGGAAAGGGG - Intronic
1149490740 17:57083669-57083691 CTTTGTTTTTTGGGGGAATAGGG - Intergenic
1149490740 17:57083669-57083691 CTTTGTTTTTTGGGGGAATAGGG - Intergenic
1149521187 17:57319391-57319413 CATTCTGAATTGAGGAAATATGG - Intronic
1149521187 17:57319391-57319413 CATTCTGAATTGAGGAAATATGG - Intronic
1153990944 18:10399885-10399907 CATTCTTCCTTGAGGTAGTAAGG - Intergenic
1153990944 18:10399885-10399907 CATTCTTCCTTGAGGTAGTAAGG - Intergenic
1156703485 18:39852319-39852341 CATTGTTTTTTTAGGGAATAGGG + Intergenic
1156703485 18:39852319-39852341 CATTGTTTTTTTAGGGAATAGGG + Intergenic
1162184019 19:8890751-8890773 CATTTTTATTTGAGTGAAAATGG + Intronic
1162184019 19:8890751-8890773 CATTTTTATTTGAGTGAAAATGG + Intronic
1163856850 19:19709302-19709324 CCTTGTTATATGTGGGAATAAGG - Intergenic
1163856850 19:19709302-19709324 CCTTGTTATATGTGGGAATAAGG - Intergenic
926552642 2:14318384-14318406 CTTTTTAAATTGAGGGAATAAGG + Intergenic
926552642 2:14318384-14318406 CTTTTTAAATTGAGGGAATAAGG + Intergenic
929170791 2:38931294-38931316 CATTCTTAATTGGGGGAATTGGG - Intronic
929170791 2:38931294-38931316 CATTCTTAATTGGGGGAATTGGG - Intronic
929473478 2:42220560-42220582 TATTGTTATCTCAGGGAATAGGG - Intronic
929473478 2:42220560-42220582 TATTGTTATCTCAGGGAATAGGG - Intronic
931161903 2:59702171-59702193 CCTTGGTCCTTAAGGGAATATGG - Intergenic
931161903 2:59702171-59702193 CCTTGGTCCTTAAGGGAATATGG - Intergenic
932063927 2:68533156-68533178 CATTCTTACATGAGGGAAGGTGG - Intronic
932063927 2:68533156-68533178 CATTCTTACATGAGGGAAGGTGG - Intronic
937950057 2:127378032-127378054 AATAGATACTAGAGGGAATAAGG + Intronic
937950057 2:127378032-127378054 AATAGATACTAGAGGGAATAAGG + Intronic
939907365 2:147933344-147933366 CATTTTTGTATGAGGGAATATGG + Exonic
939907365 2:147933344-147933366 CATTTTTGTATGAGGGAATATGG + Exonic
943799170 2:192036244-192036266 CATTGGTACTTCTGGAAATATGG - Intronic
943799170 2:192036244-192036266 CATTGGTACTTCTGGAAATATGG - Intronic
946509001 2:220334452-220334474 CATTGGGCCTTGAGTGAATATGG - Intergenic
946509001 2:220334452-220334474 CATTGGGCCTTGAGTGAATATGG - Intergenic
948420299 2:237855633-237855655 TTTTGTTTCTTGGGGGAATAGGG + Intergenic
948420299 2:237855633-237855655 TTTTGTTTCTTGGGGGAATAGGG + Intergenic
1168919382 20:1518403-1518425 CATAGTCATTTAAGGGAATATGG + Intergenic
1168919382 20:1518403-1518425 CATAGTCATTTAAGGGAATATGG + Intergenic
1170712397 20:18803445-18803467 CATTGTTACATGATTAAATACGG - Intergenic
1170712397 20:18803445-18803467 CATTGTTACATGATTAAATACGG - Intergenic
1172297920 20:33826595-33826617 CATTACTGCTTGAGGGAATGAGG + Intronic
1172297920 20:33826595-33826617 CATTACTGCTTGAGGGAATGAGG + Intronic
1173994544 20:47327695-47327717 GATTGTTCCATGTGGGAATAGGG - Intronic
1173994544 20:47327695-47327717 GATTGTTCCATGTGGGAATAGGG - Intronic
1174785654 20:53430089-53430111 CATTATTGCTTAAGGGGATAAGG + Intronic
1174785654 20:53430089-53430111 CATTATTGCTTAAGGGGATAAGG + Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
951623315 3:24630911-24630933 CAATCTTACTTAAGGGACTAAGG - Intergenic
951623315 3:24630911-24630933 CAATCTTACTTAAGGGACTAAGG - Intergenic
955215655 3:56983273-56983295 CATGGTCACTTGTGGAAATAGGG - Intronic
955215655 3:56983273-56983295 CATGGTCACTTGTGGAAATAGGG - Intronic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
958001063 3:87749523-87749545 CGTTGTAAGTTGAGGGAATAAGG - Intergenic
958001063 3:87749523-87749545 CGTTGTAAGTTGAGGGAATAAGG - Intergenic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
960772114 3:121206007-121206029 CATTTTTACTTTAGGGAAAGAGG + Intronic
960772114 3:121206007-121206029 CATTTTTACTTTAGGGAAAGAGG + Intronic
963388015 3:144621019-144621041 CATTATTACTTTAAGGAATCAGG - Intergenic
963388015 3:144621019-144621041 CATTATTACTTTAAGGAATCAGG - Intergenic
966173078 3:177104625-177104647 CATTGTTACTTAAGCGATTAGGG + Intronic
966173078 3:177104625-177104647 CATTGTTACTTAAGCGATTAGGG + Intronic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
974452318 4:62081889-62081911 CATTGTTAATTTCTGGAATATGG - Intergenic
974452318 4:62081889-62081911 CATTGTTAATTTCTGGAATATGG - Intergenic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
979566613 4:122161229-122161251 CATTGTTGCATGAGGGATTTGGG + Intronic
979566613 4:122161229-122161251 CATTGTTGCATGAGGGATTTGGG + Intronic
981703152 4:147629141-147629163 CATACTTACTTGAGGGGATCTGG + Intronic
981703152 4:147629141-147629163 CATACTTACTTGAGGGGATCTGG + Intronic
983391370 4:167134400-167134422 CGTTGTTACTGGAGGGCAAATGG + Intronic
983391370 4:167134400-167134422 CGTTGTTACTGGAGGGCAAATGG + Intronic
985149922 4:186936342-186936364 CCTTGATATTTGAGGCAATAGGG + Intergenic
985149922 4:186936342-186936364 CCTTGATATTTGAGGCAATAGGG + Intergenic
987509761 5:18822126-18822148 CATTGTTTTTTGAGTGAATGAGG + Intergenic
987509761 5:18822126-18822148 CATTGTTTTTTGAGTGAATGAGG + Intergenic
988142118 5:27256502-27256524 CTTTGTTAACTGAGGAAATATGG - Intergenic
988142118 5:27256502-27256524 CTTTGTTAACTGAGGAAATATGG - Intergenic
990735818 5:58860761-58860783 GCATATTACTTGAGGGAATAGGG - Intergenic
990735818 5:58860761-58860783 GCATATTACTTGAGGGAATAGGG - Intergenic
997090804 5:130855239-130855261 CATTTTAACTTCAAGGAATATGG + Intergenic
997090804 5:130855239-130855261 CATTTTAACTTCAAGGAATATGG + Intergenic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
1002351125 5:178584546-178584568 CATTGCTATTTGAGGGTAAAAGG + Intronic
1002351125 5:178584546-178584568 CATTGCTATTTGAGGGTAAAAGG + Intronic
1003889142 6:10548428-10548450 CATTGCTACCTGAGTGATTAGGG + Intronic
1003889142 6:10548428-10548450 CATTGCTACCTGAGTGATTAGGG + Intronic
1011124335 6:83990626-83990648 CATTTTTACTTGAATGAACAAGG + Intergenic
1011124335 6:83990626-83990648 CATTTTTACTTGAATGAACAAGG + Intergenic
1015400863 6:132786639-132786661 CATTGTTACATGAGTAAATGAGG + Intronic
1015400863 6:132786639-132786661 CATTGTTACATGAGTAAATGAGG + Intronic
1015735749 6:136398278-136398300 CATAGTAACTTGGGGGAACAAGG - Intronic
1015735749 6:136398278-136398300 CATAGTAACTTGGGGGAACAAGG - Intronic
1016927594 6:149367445-149367467 CATTTTGAATTGAGGGAACAAGG + Intronic
1016927594 6:149367445-149367467 CATTTTGAATTGAGGGAACAAGG + Intronic
1022148655 7:27575325-27575347 CATTGGGACTTGAGTAAATAAGG + Intronic
1022148655 7:27575325-27575347 CATTGGGACTTGAGTAAATAAGG + Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1031209214 7:118800986-118801008 CATGGGTACTTGAGGAAATGTGG - Intergenic
1031209214 7:118800986-118801008 CATGGGTACTTGAGGAAATGTGG - Intergenic
1031430222 7:121658799-121658821 CTTTGTTAATTGAGGAATTATGG + Intergenic
1031430222 7:121658799-121658821 CTTTGTTAATTGAGGAATTATGG + Intergenic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1033216081 7:139494726-139494748 CAGTGTAACTTGGGGAAATAAGG - Intergenic
1033216081 7:139494726-139494748 CAGTGTAACTTGGGGAAATAAGG - Intergenic
1033999321 7:147392084-147392106 CATTGTTTCTTGTGATAATATGG - Intronic
1033999321 7:147392084-147392106 CATTGTTTCTTGTGATAATATGG - Intronic
1034013170 7:147553127-147553149 CATTCTGACTTGAGGGGCTAAGG + Intronic
1034013170 7:147553127-147553149 CATTCTGACTTGAGGGGCTAAGG + Intronic
1034830831 7:154305929-154305951 CTTTGTAACTTGGGGGAAGAGGG + Intronic
1034830831 7:154305929-154305951 CTTTGTAACTTGGGGGAAGAGGG + Intronic
1036798467 8:11772442-11772464 CATTATAAATTGAGGGAACAGGG - Intronic
1036798467 8:11772442-11772464 CATTATAAATTGAGGGAACAGGG - Intronic
1038212427 8:25531978-25532000 CATTTTTACTAGAGTGAATTGGG - Intergenic
1038212427 8:25531978-25532000 CATTTTTACTAGAGTGAATTGGG - Intergenic
1038404862 8:27313985-27314007 CATTCTTGCTTGAGGGGATTGGG + Intronic
1038404862 8:27313985-27314007 CATTCTTGCTTGAGGGGATTGGG + Intronic
1042679746 8:71369729-71369751 CAAGGCTACTTGAGGGAACATGG + Intergenic
1042679746 8:71369729-71369751 CAAGGCTACTTGAGGGAACATGG + Intergenic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1048943493 8:139423510-139423532 CATTGTGAGATTAGGGAATAAGG - Intergenic
1048943493 8:139423510-139423532 CATTGTGAGATTAGGGAATAAGG - Intergenic
1050382856 9:5048875-5048897 CATTGTTATTTTAGGTAATATGG + Intronic
1050382856 9:5048875-5048897 CATTGTTATTTTAGGTAATATGG + Intronic
1052532240 9:29701489-29701511 AATTTTCACTTGAGGGAAGAAGG - Intergenic
1052532240 9:29701489-29701511 AATTTTCACTTGAGGGAAGAAGG - Intergenic
1055718003 9:79139839-79139861 AATAGCTACTTGAGGGATTATGG - Intergenic
1055718003 9:79139839-79139861 AATAGCTACTTGAGGGATTATGG - Intergenic
1060582012 9:124757557-124757579 CATGGTTACTGAAGAGAATATGG - Intronic
1060582012 9:124757557-124757579 CATGGTTACTGAAGAGAATATGG - Intronic
1060716635 9:125936611-125936633 CATTGTTATTTGAGGGAATAGGG + Intronic
1060716635 9:125936611-125936633 CATTGTTATTTGAGGGAATAGGG + Intronic
1061690487 9:132323967-132323989 AATAGTTACTTGAGGGGATGAGG + Intronic
1061690487 9:132323967-132323989 AATAGTTACTTGAGGGGATGAGG + Intronic
1187666899 X:21623274-21623296 CATTATTACTTTAGGTAAAAGGG - Intronic
1187666899 X:21623274-21623296 CATTATTACTTTAGGTAAAAGGG - Intronic
1193694369 X:84689692-84689714 GATTGTTTTTTGAGGGAATAGGG - Intergenic
1193694369 X:84689692-84689714 GATTGTTTTTTGAGGGAATAGGG - Intergenic
1196183046 X:112715921-112715943 CATTTTTACTTGGAGTAATAGGG + Intergenic
1196183046 X:112715921-112715943 CATTTTTACTTGGAGTAATAGGG + Intergenic
1196286873 X:113892940-113892962 TATTGTTTCATGAGGGAAAATGG + Intergenic
1196286873 X:113892940-113892962 TATTGTTTCATGAGGGAAAATGG + Intergenic
1196695415 X:118606468-118606490 AATTTTTACTTGAAAGAATAAGG + Intronic
1196695415 X:118606468-118606490 AATTTTTACTTGAAAGAATAAGG + Intronic
1197604273 X:128565892-128565914 CCTTGTTATTTGTGTGAATATGG + Intergenic
1197604273 X:128565892-128565914 CCTTGTTATTTGTGTGAATATGG + Intergenic
1197674919 X:129318944-129318966 CAGTTTTCTTTGAGGGAATATGG - Intergenic
1197674919 X:129318944-129318966 CAGTTTTCTTTGAGGGAATATGG - Intergenic
1198222187 X:134612892-134612914 CATTTGTACTTGAGGGTATATGG + Intronic
1198222187 X:134612892-134612914 CATTTGTACTTGAGGGTATATGG + Intronic
1202282790 Y:23207895-23207917 CATTGTAAATTAAGGGAATCGGG - Intergenic
1202282790 Y:23207895-23207917 CATTGTAAATTAAGGGAATCGGG - Intergenic
1202283101 Y:23210624-23210646 CATTGTAAATTAAGGGAATCGGG + Intergenic
1202283101 Y:23210624-23210646 CATTGTAAATTAAGGGAATCGGG + Intergenic
1202434464 Y:24822280-24822302 CATTGTAAATTAAGGGAATCGGG - Intergenic
1202434464 Y:24822280-24822302 CATTGTAAATTAAGGGAATCGGG - Intergenic
1202434775 Y:24825010-24825032 CATTGTAAATTAAGGGAATCGGG + Intergenic
1202434775 Y:24825010-24825032 CATTGTAAATTAAGGGAATCGGG + Intergenic