ID: 997232822

View in Genome Browser
Species Human (GRCh38)
Location 5:132256742-132256764
Sequence CGAGAGAACCAGAGGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997232817_997232822 -9 Left 997232817 5:132256728-132256750 CCAGATAGAAGTGCCGAGAGAAC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG 0: 1
1: 1
2: 1
3: 34
4: 362
997232815_997232822 2 Left 997232815 5:132256717-132256739 CCCTGATGTAGCCAGATAGAAGT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG 0: 1
1: 1
2: 1
3: 34
4: 362
997232816_997232822 1 Left 997232816 5:132256718-132256740 CCTGATGTAGCCAGATAGAAGTG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG 0: 1
1: 1
2: 1
3: 34
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997232822 Original CRISPR CGAGAGAACCAGAGGGAGGT TGG Intronic
900359123 1:2279460-2279482 TGAGAGAACCAGAGAGGGATGGG - Intronic
900389339 1:2427288-2427310 CGAGAGACCCAGAGGGTGAGGGG - Intronic
900779447 1:4608218-4608240 AGAGAGAGGCAGAGGGAGTTTGG - Intergenic
901143588 1:7051083-7051105 CCAGATCACCAGAGGGACGTGGG - Intronic
901494630 1:9613988-9614010 CAAGAGAACCAGGGGAAGATGGG - Exonic
901696375 1:11011279-11011301 AGAGAGAAAGAGAGAGAGGTAGG + Intergenic
902900231 1:19509965-19509987 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
903262148 1:22137131-22137153 GGAGAGAGCGGGAGGGAGGTGGG - Intronic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905868027 1:41386825-41386847 CCAAAGGACCAGAGGAAGGTTGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906828222 1:49004681-49004703 TGAGAGAAACAGAGGAAGGCAGG + Intronic
907904995 1:58776529-58776551 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
909164120 1:72195967-72195989 TGAGTGAACCTGAGGGAGGAAGG - Intronic
909740987 1:79029555-79029577 AGAGAGAAAGAGAGGGAGGGTGG - Intergenic
910043397 1:82882305-82882327 AGAGAGAAACAGAGGGAAGAAGG + Intergenic
912491906 1:110067064-110067086 GGAGAACACCAGAGGGAGGGTGG + Intronic
913668507 1:121072323-121072345 GGAGGGACCCAGTGGGAGGTAGG - Intergenic
914020251 1:143859766-143859788 GGAGGGACCCAGTGGGAGGTAGG - Intergenic
914658751 1:149767678-149767700 GGAGGGACCCAGTGGGAGGTAGG - Intergenic
915916004 1:159941429-159941451 CAAGAGCTCCAGACGGAGGTAGG + Intronic
916392407 1:164344845-164344867 CGAGAGAACCACAGGGAACGAGG + Intergenic
917000416 1:170351688-170351710 TGAGAGAAGCAGAGAGTGGTTGG + Intergenic
922549057 1:226480661-226480683 CCTGAGAACCAGGGTGAGGTGGG - Intergenic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
924145728 1:241072773-241072795 CGATAGCACCAGAGGCAGGATGG + Intronic
1063563199 10:7148290-7148312 TGAGAGCACCAGAGGGAAGAAGG - Intergenic
1063867352 10:10380257-10380279 AGAGAGAGACAGAGAGAGGTAGG + Intergenic
1065709024 10:28497685-28497707 AGAGAGAAAGAGAGGGAGGAAGG + Intergenic
1066228374 10:33407222-33407244 TGAGAGAACAGGAGGGAGCTGGG + Intergenic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1067297229 10:44981874-44981896 CTAGGGAAACCGAGGGAGGTTGG + Intronic
1069250952 10:66266090-66266112 GGAGAGAAAGAGAGGGAGGAAGG + Intronic
1069637745 10:69936026-69936048 AGAGAGAAAGAGAGGGAGGAGGG + Intronic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069753404 10:70759344-70759366 AGAGAGAGAAAGAGGGAGGTGGG - Intronic
1069777928 10:70937662-70937684 GGACAGAACCAGAGGGAGGGCGG + Intergenic
1072802601 10:98403519-98403541 AGAGAGCACCAGATGGGGGTGGG - Intronic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1074533195 10:114310918-114310940 CGGGAGAGCCAGAGGGTGGTTGG - Intronic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1075688139 10:124378134-124378156 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1076605501 10:131686892-131686914 TGAGAGAACAGGAGGGAGGGTGG - Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1077369466 11:2174696-2174718 GGAGAGGGCCAGAGGCAGGTGGG - Intergenic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078403131 11:11045231-11045253 CTAGAGAAGAAGAGGCAGGTAGG - Intergenic
1078854094 11:15192179-15192201 AGAGGGAGCCAGAGGGAGGGAGG - Intronic
1079388055 11:19998292-19998314 AGAGAGAAGGAGAGGGAGGTGGG - Intronic
1080151121 11:29053256-29053278 GGAGAGAAGGAGAGGGAGGGAGG + Intergenic
1080559060 11:33445292-33445314 GGAGAGAATCAGAGAGAAGTTGG + Intergenic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083549064 11:63572214-63572236 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1084020008 11:66411718-66411740 CGCGGGAACCACAGGGAGTTGGG - Intergenic
1084155373 11:67310158-67310180 CGCCAGAACCTGAGGGTGGTGGG + Exonic
1084591494 11:70093224-70093246 AGAGTGAAAAAGAGGGAGGTGGG - Intronic
1084596958 11:70122690-70122712 CGAGAGAGACAGAGAGAGGTAGG - Intronic
1085270148 11:75265370-75265392 AGAGAAAAGCAGAGGGAGGGAGG - Exonic
1085956688 11:81406519-81406541 AGAGACAAACAGAGGGAGGGGGG - Intergenic
1087058362 11:93955185-93955207 CCAGAGCACCAGAGGGAGTGTGG + Intergenic
1087558967 11:99759730-99759752 AGAGAGAAGGAGAGGGAGGGAGG + Intronic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1088494376 11:110418787-110418809 CCAGAGAATCAGCAGGAGGTAGG - Intergenic
1089984837 11:122803437-122803459 GAAGAGAACAGGAGGGAGGTGGG + Intronic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1091339626 11:134800374-134800396 CGGGAAAGCCAGCGGGAGGTGGG - Intergenic
1091408666 12:224675-224697 TGCAAGAACCAGATGGAGGTTGG - Intronic
1092062666 12:5564037-5564059 AGAGAGAGCCAGATGGAGGGAGG - Intronic
1092529389 12:9331908-9331930 GGAGAGGAGCAGAGGGAGGGAGG + Intergenic
1092603466 12:10092898-10092920 CGAGAGAGCAAGAGGGAGATGGG - Intronic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1097275122 12:57807838-57807860 GGAGAGAACCAGAGGGAGAAAGG - Intronic
1097641840 12:62191861-62191883 CCAGAGAACAAGAGGGAGGGCGG - Exonic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098958707 12:76715407-76715429 AGAGAGAAACAGAGGGAGAGAGG + Intergenic
1101443289 12:104719441-104719463 CGAGAGAGACAGAGTGAAGTGGG - Intronic
1101642733 12:106600379-106600401 CGAGAGAAAAAAAGGGGGGTTGG - Intronic
1102645956 12:114403979-114404001 AGAGAGAACGAGAGAAAGGTTGG + Intronic
1103185813 12:118956183-118956205 GGGGAGGGCCAGAGGGAGGTAGG + Intergenic
1103919119 12:124390317-124390339 CGAGTGACCCAGAGAGAGGCTGG - Intronic
1104399627 12:128464783-128464805 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
1106469572 13:30042476-30042498 AGGGATCACCAGAGGGAGGTTGG - Intergenic
1106559171 13:30833826-30833848 GGAGACATCCAGAAGGAGGTGGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108721868 13:53140526-53140548 GAAGAGAACTAGAGGGAGGTGGG - Intergenic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110156450 13:72322503-72322525 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1110480632 13:75971063-75971085 TCTGAGAACAAGAGGGAGGTAGG + Intergenic
1111319184 13:86603064-86603086 GGAGAGAAGAAGAGGGAGGGAGG - Intergenic
1112569172 13:100578420-100578442 CGAGAAAACCAGTGAGAGGCAGG + Intronic
1113814054 13:113159418-113159440 CGAGAGAAAAGGAGGGAGGATGG + Intronic
1114041863 14:18686268-18686290 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1114532070 14:23402614-23402636 CGAGAGACAAAGAGGGGGGTTGG + Intronic
1114537316 14:23431315-23431337 GGAGAAAAACAGAGGGAGGGAGG + Intronic
1116562389 14:46397260-46397282 TGAGATAAGCAGAGGAAGGTAGG - Intergenic
1116903392 14:50382573-50382595 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1117344625 14:54820063-54820085 GGAGGGAAGCAGAGAGAGGTGGG - Intergenic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119726114 14:76922707-76922729 CGAGAGAAGGAGAGCGAGCTGGG - Intergenic
1120739781 14:88095318-88095340 GGAGAGAAACAGAGGGAAGATGG - Intergenic
1121270082 14:92632095-92632117 CGACAGGACCAGACTGAGGTTGG - Intronic
1122059974 14:99130537-99130559 CGAGAGAGAGAGAGGGAGGGAGG + Intergenic
1122156085 14:99751248-99751270 CCTGAGAACCACAGGGGGGTGGG + Intronic
1122286542 14:100655789-100655811 GGAGAGCACCAGAGTGAGGAGGG - Intergenic
1122426367 14:101608222-101608244 AGAGAGAGACAGAGAGAGGTAGG - Intergenic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1124889166 15:33716071-33716093 CGAGAGAAAGAGTGGGAGGAAGG - Intronic
1125410993 15:39406003-39406025 CGTTAGAACCACAGGAAGGTAGG - Intergenic
1125432442 15:39609308-39609330 GGAGAGCACCAGAGCTAGGTGGG - Intronic
1127298813 15:57632864-57632886 AGAGAGAACCAAATGGAGGGAGG - Intronic
1127910899 15:63415375-63415397 CAAGAGAACCAGTGGCAGGGAGG - Intergenic
1127959216 15:63878632-63878654 CAAGAGAACCCCAGGGAGGTTGG + Intergenic
1128211541 15:65906683-65906705 AGAGAGAAACAGAGGGAGACAGG + Intronic
1128522845 15:68386896-68386918 TGAGAGAAGCAGGGAGAGGTGGG + Intronic
1129231392 15:74199037-74199059 TGGGAGAGCCAGAGGGAGGGTGG + Intronic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130226051 15:82059010-82059032 GGAGAAAACAAGAGGGAGGAGGG - Intergenic
1131268752 15:90934165-90934187 CCATAGCACCAGAGGCAGGTGGG - Intronic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1132694061 16:1194380-1194402 CCAGGGAACCAGAGGAAGGAGGG - Intronic
1132712532 16:1275942-1275964 GGTGAGAACCAGAGGGACGTGGG - Intergenic
1133754905 16:8755232-8755254 CGAGAAGACCAGAGGGAGGGAGG - Intronic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1138114167 16:54347333-54347355 CGAGAGAAAGAGAGGAAGGAAGG - Intergenic
1138174242 16:54882327-54882349 TGAAAGAACCAGAGTGAGATGGG + Intergenic
1138496471 16:57412063-57412085 CCAGAGAAGCAGAGGAATGTTGG + Intronic
1139288115 16:65833458-65833480 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1140410546 16:74738216-74738238 AGAGAGAATGAGAGAGAGGTGGG + Intronic
1140970992 16:80012223-80012245 GGATAAAGCCAGAGGGAGGTAGG + Intergenic
1141190933 16:81824120-81824142 AGAGAGAAAGAGAGGGAGGGAGG - Intronic
1141464881 16:84198760-84198782 TGGGAGAATCTGAGGGAGGTGGG + Intergenic
1141497696 16:84421228-84421250 CGCGGGAGCCACAGGGAGGTGGG + Intronic
1141839790 16:86567230-86567252 CGAGAGAGCCAGAGGGGGAGAGG - Exonic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144767750 17:17741900-17741922 CGATAGAACAGGAGGGAGATGGG + Intronic
1144996809 17:19275263-19275285 TGAGAGAACCAGAGGTAGAAAGG - Intronic
1145320810 17:21766214-21766236 CGAGAGAAGCTGGGGGAAGTAGG + Intergenic
1146058422 17:29592553-29592575 AGCAAGAACCAGAGTGAGGTTGG - Intronic
1146919220 17:36698735-36698757 AGTGAGATTCAGAGGGAGGTAGG + Intergenic
1147597406 17:41725780-41725802 TGGCAGAACCAGAGGCAGGTGGG + Intronic
1147701912 17:42401588-42401610 GGAGAGAGACAGAGGGAGGGAGG + Intergenic
1149321500 17:55486430-55486452 GGAGAGATGCAGATGGAGGTAGG - Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149655915 17:58309524-58309546 GGAGAGAACCAGAGGGACGGTGG + Intronic
1149939383 17:60846790-60846812 AGAGAGAAAGAGAGGGAGGGAGG - Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1151029305 17:70717721-70717743 ACAGAAAACAAGAGGGAGGTCGG + Intergenic
1151431066 17:74063601-74063623 TGAAAGAACCACAGGCAGGTGGG + Intergenic
1152677977 17:81651346-81651368 GGAGGGAACCAGAGGAGGGTGGG + Intronic
1154347151 18:13551672-13551694 GGAGAGAAACAGAGGGAATTTGG + Intronic
1155058236 18:22204321-22204343 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1155962891 18:32009746-32009768 CGAGAGAAAGGGAGGGAGGGAGG - Intergenic
1157470087 18:47982436-47982458 AGAGAGAGCCAGAGAGAGGGAGG + Intergenic
1157744474 18:50122601-50122623 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
1158346178 18:56519228-56519250 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
1158536155 18:58309801-58309823 CCACCCAACCAGAGGGAGGTGGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161582908 19:5090585-5090607 AGAGAGAAAGAGAGGGAGGGGGG - Intronic
1162204686 19:9046942-9046964 AGAGAGAAAAAGAGGGAGGGAGG - Intergenic
1162483117 19:10941049-10941071 AGAGAGAGACAGAGGGAGGCAGG + Intergenic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1163157536 19:15447719-15447741 CCAGACAGCCAGAGGGAGCTGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164188785 19:22896645-22896667 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1164976536 19:32577034-32577056 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1167018213 19:46855747-46855769 AGAGAGAAAGAGAGAGAGGTTGG + Intergenic
1167348907 19:48963097-48963119 ACAGAGATCCAGAGAGAGGTGGG - Intergenic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
926881804 2:17553075-17553097 AGAGAGAACAAGAGGGAGGGAGG + Intronic
927702493 2:25277041-25277063 CGGGAGCACCAGGGGGAGGGAGG + Intronic
928430157 2:31211239-31211261 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
929230901 2:39558917-39558939 CCAGATAACCAGAGAGAGGTTGG - Intergenic
929685147 2:44027000-44027022 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
931231096 2:60375455-60375477 CCACAGAATGAGAGGGAGGTGGG + Intergenic
931927201 2:67086399-67086421 AGAGAGAAGGAGAGGGAGATGGG - Intergenic
932094460 2:68835320-68835342 AGAGAGAATCAGAGGGAAGCTGG + Intergenic
932336975 2:70937231-70937253 ACAGAGGAACAGAGGGAGGTGGG - Intronic
933648415 2:84830516-84830538 AGAGTGAACCAGAGGGAGAAGGG + Intronic
933972345 2:87480401-87480423 CGAGGGATGCAGACGGAGGTTGG - Intergenic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
935245990 2:101219256-101219278 CCAGAGAAACAAAGGGAGGGAGG - Intronic
935661586 2:105471255-105471277 CTAGAGAACCAGAGAAAGCTTGG - Intergenic
936321385 2:111469787-111469809 CGAGGGATGCAGACGGAGGTTGG + Intergenic
937058914 2:118967146-118967168 AGAGAGAAACAGAGTGATGTGGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938730461 2:134143056-134143078 GGAGAGCACCAAAGGGAGGCAGG + Intronic
938950717 2:136251996-136252018 GGAGAGAACAAGATTGAGGTTGG - Intergenic
941574533 2:167214195-167214217 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
941574551 2:167214266-167214288 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
941597645 2:167497617-167497639 CTAAAGAACCTGAGGGAGATTGG + Intergenic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941947798 2:171119357-171119379 AGAGAGAACAAGAAGGTGGTGGG - Intronic
945564752 2:211383545-211383567 CCAGAGAAAGAGAGGGGGGTGGG + Exonic
946102897 2:217342203-217342225 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
946658147 2:221970944-221970966 TGAGAGAAAAACAGGGAGGTTGG - Intergenic
946777145 2:223155239-223155261 AGAGAGAGAGAGAGGGAGGTAGG - Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947197918 2:227587154-227587176 AAAGAGAACCAGGGCGAGGTTGG + Intergenic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948095912 2:235334084-235334106 AGAAAGGACCAGAGGGAGGGAGG - Intergenic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
1168856487 20:1012843-1012865 CGAGGGAGGCAGAGGGAGGGAGG + Intergenic
1172077557 20:32310915-32310937 CGAGAGAAGCGGAGGGAAGGTGG + Exonic
1172195271 20:33087253-33087275 GGAGGGAGGCAGAGGGAGGTGGG - Intronic
1172788658 20:37487217-37487239 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1172965469 20:38831287-38831309 CGTGAGACCCAGAGGGTGATGGG - Intronic
1173444088 20:43102530-43102552 GGGGAGCACCAAAGGGAGGTGGG - Intronic
1174194710 20:48764805-48764827 AGAAAGAAAAAGAGGGAGGTAGG + Intronic
1174199039 20:48794277-48794299 AGGGAGAAACAGAGGGAGATAGG + Intronic
1174418144 20:50381088-50381110 CGAGAGAGAAAGAGGGAGGAAGG + Intergenic
1174517241 20:51102023-51102045 AGAGACAATCAGAGGGCGGTTGG - Intergenic
1174532066 20:51222048-51222070 AGAGAGAGCCAGGGGGAGGAGGG + Intergenic
1175274836 20:57761209-57761231 CCAAAGGACCAGAGGGAGCTTGG - Intergenic
1176160934 20:63648274-63648296 GGAGAGAGCAAGAGGGAGTTTGG + Intronic
1176169690 20:63691186-63691208 CCAGAGAACCAAAGTGATGTGGG - Intronic
1176924128 21:14725962-14725984 AGAGAGAACCAGAGGGAGGGAGG + Intergenic
1178002145 21:28174337-28174359 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1179544584 21:42105739-42105761 CTAGAGCCCCAGAGGGAGGGCGG + Intronic
1180657554 22:17435968-17435990 CGAGACAGACAGAGGGAGGGAGG - Intronic
1181413479 22:22742961-22742983 AGAGAGAAACACATGGAGGTTGG + Intronic
1181766346 22:25094873-25094895 AGCGAGAATCAGAGGGAGGGAGG - Intronic
1182204255 22:28607814-28607836 AGAGAGAACCTGAGGGATTTGGG - Intronic
1184355354 22:43975875-43975897 AGAGAAAACCAGAGGGAAGAAGG - Intronic
1185059357 22:48598013-48598035 CGAGAGAGCGAGAGGGAGCGAGG + Intronic
950399067 3:12756770-12756792 AGAGAGAGAGAGAGGGAGGTGGG - Intronic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
951532086 3:23707267-23707289 GCAGAGAAGCAGAGGGAGTTTGG - Intergenic
952632595 3:35487546-35487568 CTAGAGTTCCAGAGGGAGGCTGG - Intergenic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
958820883 3:98972401-98972423 AGAGAGAGAGAGAGGGAGGTTGG + Intergenic
959434538 3:106298190-106298212 GGAGAGAAAGAGAGGGAGGAGGG - Intergenic
960343586 3:116505137-116505159 AGAGAGAAAGAGAGAGAGGTGGG + Intronic
961040118 3:123672238-123672260 CGAGAGAGAAAGAGGGAGGAAGG + Intronic
961315986 3:126035967-126035989 AGAGAAAACCAGTGGGAGGCAGG + Intronic
961696629 3:128709691-128709713 TGAGGTAGCCAGAGGGAGGTGGG - Intergenic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
962364030 3:134765552-134765574 GGAGAGAACCAGAGGAAGTGAGG + Intronic
962436431 3:135371432-135371454 CCAGGGAACAGGAGGGAGGTGGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
965024053 3:163275524-163275546 CGTGAAAAAAAGAGGGAGGTAGG + Intergenic
967345684 3:188453047-188453069 CCAAAGAACCCGAGAGAGGTTGG - Intronic
969615843 4:8252233-8252255 AGACAGAGGCAGAGGGAGGTTGG - Intergenic
969969047 4:11027200-11027222 AGAAAGTACAAGAGGGAGGTAGG + Intergenic
970879843 4:20916210-20916232 AGAGAGAACCTGAGAGAGTTAGG - Intronic
971147689 4:23996584-23996606 CAAGAGAAACAGAGTGGGGTTGG - Intergenic
973260743 4:48160816-48160838 AGAGAGAGACAGAGGGAGGGAGG + Intronic
973619896 4:52715745-52715767 GGAGAGAAGCAGAGGCAGTTAGG - Intergenic
977097425 4:92764040-92764062 AGAGGGAACCAGATGGAAGTAGG - Intronic
978993455 4:115118242-115118264 TGAGAGACCCAGGGTGAGGTGGG + Intergenic
979469030 4:121072784-121072806 TGAGAGAAAGAGAGGGAGGGAGG - Intronic
979994349 4:127412534-127412556 AGAGAGGAACAGAGGGAGGTGGG + Intergenic
980121327 4:128731299-128731321 AGAGAGAAAGAGAGGGAGGAAGG + Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
981542415 4:145859673-145859695 CGCGAGAACCAGAGAGAGGAAGG - Intronic
981557236 4:146008438-146008460 GGAGAGAGAGAGAGGGAGGTAGG - Intergenic
982167634 4:152629165-152629187 AGAGAGAACCAGATGGAGTTGGG + Intronic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982235377 4:153247184-153247206 CATGAGAACCAGTGGCAGGTAGG + Intronic
982967344 4:161929123-161929145 AGAGAGCAACAGAGGGAGGGAGG - Intronic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983936996 4:173509129-173509151 TGAGAAAACAAGAGGGAGGACGG - Intergenic
984115529 4:175675976-175675998 GGAGAGACCCACCGGGAGGTAGG + Intronic
984206557 4:176793079-176793101 GGAGAGATCCAGAGGGGGGCCGG - Intergenic
984423531 4:179554656-179554678 AGAGAGAACAAGAGGGAGGCAGG + Intergenic
984423582 4:179555456-179555478 AGAGAGAACAAGAGGGAGGCAGG - Intergenic
985303818 4:188517426-188517448 AGAGTGAACCAGAGGTAGATAGG + Intergenic
985945742 5:3181579-3181601 AGAGAGAACCAGGGAGAGGGAGG - Intergenic
986784185 5:11096766-11096788 AGAGAGAGACAGAGGGAGGGAGG + Intronic
987760631 5:22158437-22158459 CCAGAAAACCACTGGGAGGTTGG + Intronic
988895257 5:35665428-35665450 GGAGAGGAACAGAGGGAGGGAGG + Intronic
991470091 5:66958794-66958816 CGAGAGCATCACAGGGAGGTGGG + Intronic
991494819 5:67216462-67216484 GGGCAGAATCAGAGGGAGGTAGG + Intergenic
991895408 5:71391884-71391906 CCAGAAAACCACTGGGAGGTTGG + Intergenic
994455712 5:100004786-100004808 GGAGAGAACCAGAGTGAGGGAGG - Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995416786 5:111921781-111921803 GGAGGGACCCGGAGGGAGGTAGG + Intronic
995673375 5:114633476-114633498 TGAGGGACCCAGGGGGAGGTGGG - Intergenic
996490230 5:124086104-124086126 GGAGGTACCCAGAGGGAGGTAGG + Intergenic
996629600 5:125611646-125611668 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
996629607 5:125611668-125611690 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
997258857 5:132449988-132450010 AGGGAGACCCGGAGGGAGGTAGG - Intronic
998157022 5:139792782-139792804 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
998157453 5:139795121-139795143 AGAAAGAACCTGAGGGAGGCGGG - Intergenic
998203842 5:140145647-140145669 GGTGAGAACAAGAGGGAGATTGG + Intergenic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
1001160435 5:169307907-169307929 TGAGAGAAACAGAGGGAGGGTGG + Intergenic
1001591134 5:172866253-172866275 GGAGAGAAGCGGAGGGAGGTGGG + Intronic
1001690924 5:173631730-173631752 AGAGAGAAAGAGAGGGAGGAAGG - Intergenic
1001744959 5:174085393-174085415 AAAGAGAACCAGTGTGAGGTGGG - Intronic
1003253207 6:4450984-4451006 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1003369519 6:5510759-5510781 CAAGAGGACAAGAGGGGGGTGGG - Intronic
1003635737 6:7829814-7829836 CGCCACAAGCAGAGGGAGGTTGG + Intronic
1004021921 6:11783673-11783695 GGAGAGAGCCAGTGGGAAGTGGG - Intronic
1004140492 6:13013608-13013630 CGTGAGACCCCGAGAGAGGTGGG + Intronic
1004562256 6:16761563-16761585 CGAGAGAGCGCGAGGGAGGGAGG - Intergenic
1006374174 6:33662766-33662788 GGAGGGACTCAGAGGGAGGTAGG - Intronic
1006388982 6:33747656-33747678 CCAGAGGCCCAGAGGCAGGTGGG + Intergenic
1006826422 6:36939294-36939316 GCAGAGGACCAGAAGGAGGTTGG + Intergenic
1007359811 6:41346818-41346840 AGAGAGAAAGAGAGGGAGGGAGG + Intronic
1008196792 6:48534186-48534208 CGAGAGAATAAGGGGGAGGTTGG + Intergenic
1008287326 6:49669968-49669990 TTAGAGAACTAGAGGGAGGAAGG - Intergenic
1012957414 6:105586393-105586415 CGAGAGAAAGAGAGAGAGGCAGG + Intergenic
1013608499 6:111773286-111773308 GGAGAGAAAGAGAGGGAGGGAGG + Intronic
1015203966 6:130614234-130614256 AGAGTCAACCAGATGGAGGTTGG + Intergenic
1017746781 6:157454136-157454158 TGAGATAACCAAAGGGATGTAGG - Intronic
1019517841 7:1447539-1447561 CCAGAGAACCAGGGGGAGGGTGG + Intronic
1019627969 7:2030829-2030851 CGAGAGCACCAGGCGCAGGTTGG - Intronic
1019739905 7:2667515-2667537 ACATTGAACCAGAGGGAGGTGGG + Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020011506 7:4808061-4808083 GGAGAGAGACAGAGGGAGGGAGG - Intronic
1020206034 7:6116993-6117015 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1022107200 7:27205104-27205126 CGTTAGAAGCAGAGGGAGCTTGG + Intergenic
1023033773 7:36112692-36112714 GGAGAGAACCAGAGTGAGTAAGG + Intergenic
1024304359 7:47914718-47914740 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1024939268 7:54745326-54745348 CAATAGAACTAGAAGGAGGTAGG - Intergenic
1025066400 7:55859654-55859676 TGAGAGAAAGAGAGGGAGGAAGG - Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1028222568 7:88214894-88214916 TGAGAGAAACAGCTGGAGGTAGG - Intronic
1029525465 7:101091238-101091260 CGTGGGAACCAGAGGGATTTTGG + Intronic
1030553672 7:110996366-110996388 AGAGAGAACGAGAGGGGGGTTGG + Intronic
1031975205 7:128089352-128089374 CCAGAGAACCCTAGTGAGGTTGG - Intronic
1032028826 7:128464654-128464676 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1032329206 7:130962074-130962096 GGAGTGAAGCAGAGGTAGGTGGG - Intergenic
1032353201 7:131185053-131185075 CGAGAGGAGGAGAGGGTGGTGGG + Intronic
1032507008 7:132443133-132443155 CAAGAGAATCTGAGGGAGCTAGG - Intronic
1032793617 7:135260149-135260171 GGAGAGAAGCAGAGGGCTGTTGG - Intergenic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1037926644 8:22848635-22848657 CCAGAGAAAAAGAGGCAGGTGGG + Intronic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1039365921 8:36927921-36927943 AGAGAGAACTAGAGGGAGGGAGG + Intronic
1039845121 8:41320595-41320617 AGAGAGGAAGAGAGGGAGGTAGG - Intergenic
1039845128 8:41320620-41320642 AGAGAGAAAGAGAGGGAGGTGGG - Intergenic
1040361990 8:46674360-46674382 TGAGAGAACTAGAGGGAGGAAGG + Intergenic
1041097259 8:54362051-54362073 GGAGTGAGCCTGAGGGAGGTTGG + Intergenic
1041568295 8:59305715-59305737 AGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1041995043 8:64044619-64044641 AGAAAGAAAGAGAGGGAGGTAGG + Intergenic
1043328066 8:79078075-79078097 CGAGCGAACCCCAGGGAGGCAGG - Intergenic
1046195083 8:110851971-110851993 CGAGAGGACTAAAGGGAGGCTGG + Intergenic
1046283933 8:112071403-112071425 GTAGAGGACCAGAGGGAGGTGGG - Intergenic
1046846800 8:118925849-118925871 AGAGAGAAACAGAGAGAGATAGG - Intronic
1047368587 8:124236047-124236069 GGAGAGAACCACAGAGAAGTGGG - Intergenic
1048034655 8:130666068-130666090 GAAGAGTACCAGAGAGAGGTTGG + Intergenic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1050527758 9:6560917-6560939 AGAGGGAAGCAGAGGGAGATGGG + Intronic
1051345913 9:16151205-16151227 CAAGAGTGCCAGAGGAAGGTGGG + Intergenic
1055533316 9:77210152-77210174 AGAGAGAGAGAGAGGGAGGTGGG - Intronic
1055767630 9:79681754-79681776 GGAGAGAAAGAGAGGGAGGGAGG + Intronic
1056761014 9:89414947-89414969 GGAGAGAGACAGAGGGCGGTGGG + Intronic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057806400 9:98222927-98222949 AGAGAGAACCAGAGAAAGGATGG - Intronic
1058598320 9:106640328-106640350 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1059507265 9:114810967-114810989 CAAGAGAACCAGATGGGGGGAGG - Intergenic
1060468678 9:123929975-123929997 GGAGAGCGCCAGAGGGAGGCCGG - Exonic
1060734541 9:126058591-126058613 AGAGAGAACCAGAGAAAGGGCGG - Intergenic
1061291043 9:129650451-129650473 CGAGAGAGGCAGAGGCAGGAAGG + Intergenic
1061381869 9:130263747-130263769 CGAGAGCAGCAGCGGGGGGTGGG - Intergenic
1061617500 9:131790055-131790077 TGAGAAAACCACAGGCAGGTGGG + Intergenic
1062176388 9:135165521-135165543 CGAGAGAACCACAGGGAAGCAGG + Intergenic
1062365985 9:136209293-136209315 CGGGAGAGCCAGAGGGAAGGAGG + Intronic
1062392963 9:136341272-136341294 CGAGGGCTCCAGGGGGAGGTGGG - Intronic
1062534718 9:137016419-137016441 GCAGACAACCAGAGGCAGGTGGG + Exonic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1186532609 X:10312431-10312453 AGAGAGAAAGAGAGGGAGGGGGG - Intergenic
1186776047 X:12865642-12865664 GGAGGGAGCCAGAGGGAGGCAGG + Intergenic
1186854004 X:13608507-13608529 GGAGAGAAATAGAGGGAGGAAGG - Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188857915 X:35220477-35220499 GGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1190055514 X:47179170-47179192 GGAGAGCACGAGAGGTAGGTGGG - Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1192024734 X:67437427-67437449 AGAGAGAACAGGAGGGAGGAAGG - Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192925207 X:75748557-75748579 AGAGAGAACCTGAGGTGGGTAGG - Intergenic
1192947920 X:75985691-75985713 AGAGAGAACCTGATGTAGGTGGG - Intergenic
1195129117 X:101837483-101837505 CCAGAGAGCCAGAGGTGGGTAGG - Exonic
1195177135 X:102322355-102322377 CCAGAGAGCCAGAGGTGGGTAGG + Intronic
1195181729 X:102364738-102364760 CCAGAGAGCCAGAGGTGGGTAGG - Intronic
1197485340 X:127042872-127042894 AGAGAGAAAGAGAGGGAGGGAGG + Intergenic
1199524342 X:148775765-148775787 AGAGAGAGGCAGAGGGAGTTTGG - Intronic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1202169302 Y:22024097-22024119 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202222059 Y:22562268-22562290 GCAGAGAACCAGAGGAAGGAGGG + Intergenic
1202321056 Y:23633399-23633421 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202549711 Y:26036657-26036679 GCAGAGAACCAGAGGAAGGAGGG + Intergenic