ID: 997234468

View in Genome Browser
Species Human (GRCh38)
Location 5:132264829-132264851
Sequence ACCCTGTGCTCTCACTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997234466_997234468 2 Left 997234466 5:132264804-132264826 CCTGTTGAGCTGGCTGGAGTGAG 0: 1
1: 0
2: 4
3: 19
4: 358
Right 997234468 5:132264829-132264851 ACCCTGTGCTCTCACTCCCAGGG 0: 1
1: 0
2: 1
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997234468 Original CRISPR ACCCTGTGCTCTCACTCCCA GGG Intronic
901130744 1:6961550-6961572 GCCCTGGGCTCTCACGCCCCCGG - Intronic
901964100 1:12851968-12851990 ACCTTGTGATCTGACTCCCTCGG - Intronic
902090487 1:13899035-13899057 AAGCTGTGCTCCCATTCCCATGG - Intergenic
902114788 1:14112509-14112531 ACACTCTCCTCTCACTCCCAGGG + Intergenic
902408278 1:16198451-16198473 AGCCTGTGCCCTCAATGCCAAGG + Exonic
903154388 1:21434301-21434323 ATCCTGTGCTCTCTCCCCCAGGG + Intergenic
904337769 1:29809364-29809386 TCTCTGTCCTCTGACTCCCAAGG - Intergenic
904981527 1:34506947-34506969 CCCCTGTGCTCTCACTATCCTGG - Intergenic
905224306 1:36469104-36469126 ATCCTCTCCTCTCTCTCCCAAGG - Intronic
905477869 1:38241656-38241678 CCCCTCTGCTCACTCTCCCAGGG + Intergenic
905626616 1:39493720-39493742 ACCCTGTCCTCTAACTACAAAGG - Intronic
905666142 1:39764193-39764215 ACCCCGTGCCCTCCTTCCCAGGG - Intronic
905670274 1:39786736-39786758 ACCCTGTCCTCTAACTACAAAGG + Intronic
906742456 1:48196139-48196161 TCCCTCTGCTGTCTCTCCCAAGG + Intergenic
907421255 1:54348802-54348824 GCCCTGTGAACTCACTTCCAAGG - Intronic
907445778 1:54506854-54506876 ACCCTGTCCTGTCTCCCCCACGG - Intergenic
908868162 1:68576069-68576091 ACCCTCTGCTCTCAAGGCCAAGG + Intergenic
910809844 1:91225056-91225078 ATTCTGTGCTTTCACTGCCATGG + Intergenic
911101442 1:94098858-94098880 GCCCTGTGCTCCCTCTCCCAGGG - Exonic
912959364 1:114181511-114181533 TCCCTGTGCTCTCTCTTCCCAGG + Intergenic
913276657 1:117144920-117144942 ATCCTGTCCTCTCACTCCCCAGG + Exonic
914956080 1:152163867-152163889 AACCTGTGCACTCAATCCCCAGG - Intergenic
916212211 1:162368163-162368185 CCCCTGGGCTCTCACACCAAGGG - Exonic
916660280 1:166917179-166917201 ACCCAGTGCTGGCACTTCCAAGG - Exonic
917235007 1:172882538-172882560 ACCCTGTGCTACCACTATCATGG - Intergenic
918428469 1:184434631-184434653 ACCCAGTGCTGCCACTCACAGGG - Intronic
922609348 1:226912943-226912965 CTCCTGTTCTCTCCCTCCCAGGG + Intronic
923685217 1:236148832-236148854 ACCCTGCTCCTTCACTCCCAGGG - Intronic
924289839 1:242525118-242525140 ACCCTCTGCTCTAAGTCCCTTGG - Intergenic
1064399837 10:15012270-15012292 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1065917735 10:30366747-30366769 ACCATGTGCCCTCATGCCCAGGG - Intronic
1067523712 10:47026355-47026377 TCCCTGACCCCTCACTCCCAGGG + Intergenic
1068744627 10:60516319-60516341 TACCTGTGCCCTCAGTCCCATGG - Intronic
1069759311 10:70797858-70797880 CCCCTGAGCTCTCCATCCCAGGG + Intergenic
1071131680 10:82400947-82400969 ACCCTGTGCTATCTCTTCCTTGG + Intronic
1071523653 10:86346039-86346061 CCCCTGTGCTCCCACACCCCTGG + Intronic
1071574464 10:86715538-86715560 TCCCTGTGCTCTGACTGCCTGGG + Intronic
1073064554 10:100750414-100750436 AGGCTGGGCTTTCACTCCCACGG + Intronic
1074201223 10:111237247-111237269 ACCCTGTGCTCCAACTCCTCTGG - Intergenic
1074546942 10:114408526-114408548 ACCCAGTGTTCTAACTCCCCTGG - Intergenic
1074917725 10:117973696-117973718 TTCCTGTTCTCTCTCTCCCAAGG - Intergenic
1076226556 10:128781046-128781068 GCCCTGTGAAGTCACTCCCAGGG - Intergenic
1076435011 10:130434676-130434698 ACCCAGTTTTCTCCCTCCCAGGG - Intergenic
1077036417 11:497051-497073 CCCATGTGCTCACACTCACATGG + Intronic
1077036423 11:497122-497144 CCCATGTGCTCACACTCACATGG + Intronic
1077036453 11:497474-497496 CCCATGTGCTCACACTCACACGG + Intronic
1077135589 11:996621-996643 GCACACTGCTCTCACTCCCAGGG - Intronic
1077539743 11:3140887-3140909 CCCCTGGGCTGTCACACCCATGG - Intronic
1078079262 11:8192341-8192363 ACCCTGTGCCCTCTCTCTCCTGG + Intergenic
1080550839 11:33372994-33373016 ACCCCTTGCTCACATTCCCATGG + Intergenic
1084227402 11:67725781-67725803 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1084705949 11:70816034-70816056 ACCCTGTGCTCCCTGCCCCATGG + Intronic
1084807792 11:71591066-71591088 ACCTTATCCTCTCCCTCCCAGGG + Intronic
1084811828 11:71616639-71616661 ACCTTATCCTCTCTCTCCCAGGG + Intergenic
1084844907 11:71891085-71891107 ACCTTATCCTCTCCCTCCCAGGG + Intronic
1084847675 11:71913049-71913071 ACCTTATCCTCTCTCTCCCAGGG + Intronic
1084991798 11:72932586-72932608 ACTCTCTGCTTTCTCTCCCATGG + Intronic
1086398572 11:86442298-86442320 ACCCAGTGCTCTCTCAGCCAGGG - Intronic
1088353668 11:108918953-108918975 ACCCTGTGCTAGCACTTCAAGGG - Intronic
1090067948 11:123519297-123519319 TCCCTGTCCTCTCCCTCCCTTGG - Intergenic
1090906316 11:131077378-131077400 TCCCTGTACTATCATTCCCATGG - Intergenic
1091724732 12:2837897-2837919 TCCTTGTGTTCTCTCTCCCAAGG + Intronic
1092432076 12:8418029-8418051 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1092435040 12:8440895-8440917 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1096596494 12:52699175-52699197 ACTCTGTGGTGGCACTCCCAGGG + Intronic
1096781581 12:53995158-53995180 ACCCTGAGCTCTCCTTCCCAAGG + Intronic
1101565629 12:105902272-105902294 AACCTGTGCTCTCCCTGCTAGGG + Intergenic
1104653881 12:130558635-130558657 AGCCTGTGGTGTCACTCACAGGG + Intronic
1104820587 12:131675270-131675292 ACCCAGGACCCTCACTCCCAGGG + Intergenic
1106124536 13:26889516-26889538 ACCCTGTTCCCTCCCTGCCAGGG - Intergenic
1107031382 13:35857500-35857522 ACCCTGAACTCTCTCTCTCAGGG + Intronic
1107791916 13:44011222-44011244 ACCCTGTGCTGTGACACTCAGGG - Intergenic
1114500668 14:23165937-23165959 ACCCTCTTCTCACACTACCAAGG - Intronic
1117039095 14:51753565-51753587 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
1121760438 14:96440424-96440446 ACCCTCTGCTCTCTCTCCCTTGG + Intronic
1122370740 14:101227696-101227718 TCCCTGGGCTCTCCCTCCCATGG - Intergenic
1122616383 14:103020666-103020688 GCCCTGTGCTCTCTCTCTCACGG - Intronic
1123473315 15:20570417-20570439 ACCACGTGCCCTCACACCCAGGG + Intergenic
1123644693 15:22429936-22429958 ACCACGTGCCCTCACACCCAGGG - Intergenic
1123666010 15:22609844-22609866 ACCACGTGCCCTCACACCCAGGG - Intergenic
1123733615 15:23165428-23165450 ACCACGTGCCCTCACACCCAGGG + Intergenic
1123751743 15:23362803-23362825 ACCATGTGCCCTCACACCCAGGG + Intronic
1124284115 15:28386727-28386749 ACCACGTGCCCTCACACCCAGGG + Intronic
1124298582 15:28524887-28524909 ACCACGTGCCCTCACACCCAGGG - Intronic
1124319833 15:28704257-28704279 ACCACGTGCCCTCACACCCAGGG - Intronic
1124406847 15:29400778-29400800 AATCTGTGTTCTCAATCCCAGGG + Intronic
1124482678 15:30091173-30091195 ACCACGTGCCCTCACACCCAGGG + Intronic
1124489135 15:30143265-30143287 ACCACGTGCCCTCACACCCAGGG + Intronic
1124520899 15:30406045-30406067 ACCACGTGCCCTCACACCCAGGG - Intronic
1124537763 15:30560174-30560196 ACCACGTGCCCTCACACCCAGGG + Intronic
1124625060 15:31302976-31302998 TCCCTGGGCTCTCTCTGCCAGGG + Intergenic
1124760893 15:32447412-32447434 ACCACGTGCCCTCACACCCAGGG - Intronic
1124777741 15:32601651-32601673 ACCACGTGCCCTCACACCCAGGG + Intronic
1126574683 15:50185086-50185108 ACCCTGTGACCTCCCTCTCAGGG - Intronic
1128161580 15:65426174-65426196 TCCCTGTGCTCTCACAGCCCAGG - Intergenic
1129030039 15:72611345-72611367 ACCATGTGCCCTCACGCCCAGGG + Intergenic
1129038261 15:72664093-72664115 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129194564 15:73956198-73956220 ACACTGTGCGCTCCCACCCAGGG + Intergenic
1129398776 15:75267946-75267968 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129402384 15:75292222-75292244 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129728750 15:77917413-77917435 ACCATGTGCCCTCATGCCCAGGG - Intergenic
1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG + Intergenic
1132925340 16:2426360-2426382 ATCCAGTGCACTCCCTCCCAGGG + Intergenic
1132995198 16:2819120-2819142 ACCCAGTTCTCTCCCTTCCAGGG + Intronic
1133064409 16:3195873-3195895 ACCCTATGTTCTCAGTCCCAAGG - Intergenic
1133346827 16:5076731-5076753 ACCCTGTGCTACCACTGCAAAGG - Intronic
1134391678 16:13825635-13825657 ACCCTGTGTTCTCATTTGCAGGG - Intergenic
1135846296 16:25921697-25921719 AGCCTTTGCTCTCACTACCCTGG + Intronic
1137637271 16:49997631-49997653 AGCTTGTGCTCTCTCTCCCAGGG + Intergenic
1138006187 16:53340063-53340085 CCTCTGTGCACTCACTCCCAAGG + Intergenic
1138510178 16:57504097-57504119 CCCCTCTGCCCTCAGTCCCAAGG - Intergenic
1139191588 16:64869764-64869786 TCCCTGTGCTCTGACCACCACGG + Intergenic
1139487114 16:67264160-67264182 ACCCTGTGTTCTCAGTTCCCTGG - Intronic
1139527449 16:67525634-67525656 ACCCTCTGCTGTCTGTCCCAGGG + Intronic
1139965348 16:70742214-70742236 ACCCTCGGCTCTCCCTCCCCAGG - Intronic
1140792359 16:78404333-78404355 ACCTTGTGCTCTCACACCTAGGG - Intronic
1142190810 16:88716482-88716504 ACGCTGTGTTCCCACCCCCAGGG - Exonic
1142523528 17:521522-521544 ACCCTGTGCTTTCAAAACCAAGG + Intronic
1143651394 17:8266031-8266053 ACCCTGTGCGCTATCTCCCCAGG - Intronic
1143703369 17:8678783-8678805 TCACTGTGCCCTCACTCCCCAGG + Intergenic
1144077725 17:11734072-11734094 ACCCTCTGCTGTCACTCTCAGGG - Intronic
1147377598 17:40032205-40032227 TAAGTGTGCTCTCACTCCCAGGG - Intronic
1147653222 17:42073611-42073633 ACCCTGTGCTTTGATTCCCTGGG - Intergenic
1147760873 17:42796591-42796613 TCCCTGGGCTCTCCCTCCCTTGG - Intronic
1149091552 17:52789162-52789184 ACCCTCTGCTCTCACACACTGGG + Intergenic
1149392049 17:56201966-56201988 CCTCTGTGCTCTGGCTCCCATGG - Intronic
1149849198 17:60025565-60025587 ACCCCGTGCGCGCACTCCCTCGG - Intergenic
1149860970 17:60120959-60120981 ACCCCGTGCGCGCACTCCCTCGG + Intergenic
1151249243 17:72820853-72820875 ACCCTGTGCTCTGACTTGCTGGG - Intronic
1151335409 17:73436737-73436759 ACCATGCGCTCTCTTTCCCATGG + Intronic
1151381416 17:73728213-73728235 ACCCTCAGCTCCCACTCCCCCGG - Intergenic
1152690369 17:81715282-81715304 ACCCTGCTTTCTCACTCCCTGGG - Intronic
1153222609 18:2875056-2875078 ACCCTGTGCTTTCTCTTCCCAGG - Intronic
1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG + Intronic
1156258445 18:35422280-35422302 ATGCTGTGCTCTGACCCCCAGGG - Intergenic
1156321491 18:36029329-36029351 AACCAGTCCTCTAACTCCCACGG + Intronic
1157248065 18:46071375-46071397 CCTCTGTCCTCTCACTCCCCAGG - Intronic
1157523337 18:48360574-48360596 ACCGTGTTCTCTCCCTCCCCTGG - Intronic
1158841742 18:61395124-61395146 ACCCTCTGCTCTCTGTCCCCTGG + Intronic
1159793828 18:72817368-72817390 GGCCGATGCTCTCACTCCCATGG - Intronic
1160725089 19:614298-614320 ACCCTGTGCATTCCCTCCCTTGG - Intronic
1160738271 19:674594-674616 ACCCTGTGTTCTCACTGACGGGG - Intergenic
1160856033 19:1218396-1218418 CCCCTGTCCTCTCTGTCCCAGGG + Exonic
1160889180 19:1368326-1368348 ACCCTGTGCTCTCAGAACCCAGG - Intronic
1161176032 19:2842321-2842343 TCCCTGGGCTCTCACACACAAGG + Intronic
1162422664 19:10574723-10574745 AGCCTGTGCTCCCTCTCCCCCGG - Intronic
1162938365 19:13993443-13993465 GCCCTGTGCCTTCACACCCAGGG + Intronic
1163796015 19:19338330-19338352 ACCATGTGCACGCACACCCAAGG + Intronic
1164389390 19:27805088-27805110 ACACTGTGCTCCGCCTCCCAGGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1164908392 19:31985853-31985875 CCCTGGTGCACTCACTCCCAGGG - Intergenic
1164932621 19:32187061-32187083 ACCTTGTGCTCACACCTCCAGGG + Intergenic
1165226662 19:34359736-34359758 TCCCTCTGCCTTCACTCCCATGG + Intronic
1165371285 19:35407978-35408000 ACCCTGTGCTTTGTCTCCCATGG + Intergenic
1165441371 19:35830230-35830252 CCACTCTGCTCTCACTCCCCTGG - Intronic
1166997258 19:46725578-46725600 ACCCTGCGCTCGCACTACGACGG - Exonic
1167337697 19:48896757-48896779 ACCCTGTCCTCTCATCCCCCAGG + Intronic
926062640 2:9813767-9813789 ATCCTGTGCTGAAACTCCCAGGG + Intergenic
926921472 2:17944662-17944684 ACACTGTGCTAGCACACCCAGGG + Intronic
927308926 2:21606123-21606145 ACTTTCTGCTCTCACTCCCAAGG - Intergenic
929545803 2:42854678-42854700 ACTCTGTGCTTTGCCTCCCATGG - Intergenic
931464486 2:62474651-62474673 ACCCTGGGCTGTGTCTCCCATGG - Intergenic
932541992 2:72664768-72664790 ACGCTGTGCACACACTCCTATGG - Intronic
933803330 2:85980349-85980371 ACCCTAACCTCTCACTCCCACGG + Intergenic
934866641 2:97819971-97819993 ACCCTGTGATCCCACACACAAGG - Intronic
934896553 2:98124729-98124751 AGCCTGTGCTCTCATCCCCTAGG - Intronic
935191002 2:100778810-100778832 TCCCGATGCTCTCCCTCCCATGG - Intergenic
936043138 2:109165076-109165098 ATTCTGTGTTCTTACTCCCAGGG + Intronic
938079994 2:128364795-128364817 GCCCAGTGCCCACACTCCCAGGG + Intergenic
940872490 2:158871253-158871275 ACCTTATCCTCTCCCTCCCATGG + Intergenic
940874686 2:158887237-158887259 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
941853415 2:170206782-170206804 AGCCTCTGCCCTCACTACCATGG - Intronic
945104253 2:206294443-206294465 ACCTTGTCCTCTCTCTGCCAAGG - Intronic
945326157 2:208485227-208485249 ATTCTGTGCTCTCTCTCCCTAGG - Intronic
946407440 2:219499063-219499085 ACCCTGGCCTCTCATTGCCAGGG - Exonic
947532969 2:230924407-230924429 ACTTTGTGTTCTCACTCTCAGGG + Intronic
947534936 2:230934471-230934493 ACCCTGAGCTCTTGGTCCCAGGG + Intronic
948741928 2:240053939-240053961 CCCCTGTGCTCTTCCTCTCAGGG + Intergenic
1170702131 20:18713092-18713114 AGCCTCTGCTCCCCCTCCCATGG + Intronic
1170943404 20:20867851-20867873 ACCCTGTGCTCTGGCTCTCTTGG + Intergenic
1172361694 20:34317149-34317171 ACCCTCTGCTTTTACCCCCAAGG - Intergenic
1174290765 20:49506922-49506944 ACACTGGGCTCACATTCCCAAGG - Exonic
1174904290 20:54534122-54534144 ACCCTGAGCTCAAATTCCCAAGG - Intronic
1176083571 20:63285770-63285792 ACACCCTGCTCTCACGCCCAGGG - Intronic
1179885791 21:44313777-44313799 ACCCGGCTCTCTCACACCCATGG - Intronic
1180053470 21:45344605-45344627 TGCCTGTGCTCTCACTCCCACGG - Intergenic
1180229661 21:46419501-46419523 GCCCTGTGCTGTCACAGCCAAGG + Intronic
1180735595 22:18014191-18014213 ACCCTGTGCTCTTTTTCCTAAGG - Intronic
1181558276 22:23684631-23684653 CACCTCTGTTCTCACTCCCAGGG + Intergenic
1181562564 22:23714450-23714472 ACCCTGTGGTCTTCCTGCCAGGG - Intergenic
1185179387 22:49350333-49350355 TCCCTGGGCTCTCACACCCTGGG - Intergenic
1185416915 22:50715566-50715588 ACCCCACGCTCTCACTCCAATGG - Intergenic
950274790 3:11650621-11650643 CCGCTGTGCTCTTCCTCCCAGGG + Intronic
950557298 3:13703423-13703445 TCCATGTGCTCTCACCCCAATGG - Intergenic
950582422 3:13871307-13871329 CCTCAGTGCTCTCACCCCCATGG - Intronic
950788194 3:15452847-15452869 TCTCTGTGCTCTCTCTTCCAAGG - Intronic
950950522 3:16993411-16993433 TCCCAGTGCTCTCTCTCCAAAGG + Intronic
953709340 3:45256993-45257015 ACCCTGTGATCTGCCTGCCACGG - Intergenic
954371368 3:50171079-50171101 GCCCTGTGCTCACAATACCAAGG - Intronic
955350834 3:58191890-58191912 ACCCCATGCTCTCCCTCCCTGGG - Intergenic
955677207 3:61461267-61461289 ACCCTGTGATCTCTGTCTCAAGG + Intergenic
957075885 3:75603029-75603051 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
957332223 3:78780019-78780041 ACCACGTGATCTCACTCACAAGG + Intronic
958573878 3:95922567-95922589 TCCATGTGCTTTCACTTCCAAGG - Intergenic
959754282 3:109878298-109878320 ACCATGTGTTCTCACTCATAAGG + Intergenic
960036892 3:113110994-113111016 ACTCTTTGCCCTCACACCCAAGG - Intergenic
961272546 3:125699916-125699938 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
961278318 3:125744775-125744797 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
962752557 3:138444605-138444627 ACCCTGTGTTCTAAGTCCCTGGG + Intronic
967270725 3:187729867-187729889 AGGCTCTGCTCTCACACCCAGGG + Exonic
968554890 4:1241848-1241870 ACCCTGTGCCCTCCGTCCCCTGG - Intronic
968988442 4:3892626-3892648 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
969024054 4:4159730-4159752 ACCTTATTCTCTCCCTCCCAGGG - Intergenic
969729777 4:8947414-8947436 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
969734518 4:8978090-8978112 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
969785934 4:9456966-9456988 ACCTTATCCTCTCACTCCCAGGG + Intergenic
969789358 4:9481372-9481394 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
972655271 4:41057941-41057963 AGCCTGTCCTCTCACACACATGG + Intronic
973750679 4:54017551-54017573 AACCTGTCCCCTCACCCCCAGGG - Intronic
973757751 4:54092170-54092192 ACCCGGCGCTCTTGCTCCCACGG - Intronic
974462576 4:62206787-62206809 AACCAGTGCTCTCACACCGAAGG - Intergenic
974968515 4:68795793-68795815 ACTGTGTGCTCTCACTCATAAGG + Intergenic
975759219 4:77601900-77601922 AGCCTGAGCTCTCACCTCCAAGG + Intronic
980353340 4:131711763-131711785 ACCCTGTGATCTAACCCCCTCGG + Intergenic
980875850 4:138661341-138661363 ACCCTGGGGTCTCAGTCCCAGGG + Intergenic
982430412 4:155315752-155315774 ACCCAGTGCTTGTACTCCCATGG + Intergenic
985287568 4:188351931-188351953 ACCCTGTGATCTCACTCATGTGG - Intergenic
988632180 5:32943403-32943425 TCCCTCTGCTCTCACTGCCAAGG + Intergenic
988870685 5:35385600-35385622 ACTGTGTGCTCTCACTCTGAGGG - Intergenic
990070764 5:51780442-51780464 ACACTGAGTTATCACTCCCATGG - Intergenic
992126056 5:73642707-73642729 CTCCTCTGCTCTCACTCCCAGGG + Intronic
993392955 5:87343979-87344001 ACCATGTGTTCTCACTCATATGG + Intronic
994350711 5:98742798-98742820 CCCCTGGGGTCTCAGTCCCAGGG - Intergenic
995134895 5:108670666-108670688 ACCCTGTGCCCTGACACCCCTGG - Intergenic
996200823 5:120670488-120670510 ACCATTTGCTCTCACTGTCATGG - Intronic
996791516 5:127298478-127298500 ACCCTGTGCTCTGACTTCAGAGG + Intronic
997076167 5:130680311-130680333 ACCGTGTGTTCTCACTTTCAAGG - Intergenic
997234468 5:132264829-132264851 ACCCTGTGCTCTCACTCCCAGGG + Intronic
1000397230 5:160788572-160788594 ACCCTCTGGACTCTCTCCCAGGG - Intronic
1002819662 6:712957-712979 AGCATCTGCTCTCACTCCCAGGG + Intergenic
1003365668 6:5472403-5472425 CCCCTTTGCTCTCACCCCTAGGG - Intronic
1004456469 6:15796324-15796346 GCCCTGTGCTCTCCCTCTCCAGG - Intergenic
1005738090 6:28767646-28767668 ACCCTGTGCCCTCACACTAAGGG - Intergenic
1006675237 6:35757960-35757982 CCCCTCTGCTCTCTCTGCCATGG + Intergenic
1007239908 6:40417348-40417370 GACCTGTGCTCTGACTCCCAAGG - Intronic
1007701244 6:43767832-43767854 ATTCTGTGCCCTCACTCCCCTGG + Intergenic
1007813738 6:44505266-44505288 ATCCTGTCCTCTCTCTCACAGGG - Intergenic
1009031886 6:58069102-58069124 ATTCTGTGCTTTCACTGCCATGG - Intergenic
1009207715 6:60823553-60823575 ATTCTGTGCTTTCACTGCCATGG - Intergenic
1018228268 6:161651409-161651431 ACCCTCTGCTCCCACCCTCAGGG - Intronic
1018849905 6:167579421-167579443 ACCCTGTGCCCTGACTCCTCAGG - Intergenic
1019145028 6:169970865-169970887 AGCCAGTGCTCACACCCCCAGGG - Intergenic
1019152725 6:170019587-170019609 CCCCTGTGCCCCCACGCCCAGGG + Intergenic
1020306722 7:6841344-6841366 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1022248649 7:28585342-28585364 ACCCTGGGCTCTCCTTCCCCAGG - Intronic
1022562927 7:31368898-31368920 CACCTGTGCACTCCCTCCCACGG - Intergenic
1022877898 7:34553454-34553476 ACTGTGTGCTCTAACTCTCAGGG - Intergenic
1022952356 7:35351057-35351079 AGCCTTCTCTCTCACTCCCATGG + Intergenic
1024209672 7:47192528-47192550 CCTCTGTGCTCTTCCTCCCAAGG - Intergenic
1026431852 7:70355642-70355664 ACACTCTGCTCTCACTGGCAGGG - Intronic
1028331830 7:89604562-89604584 ACCCTGTGCTGTCTCTCCCCAGG + Intergenic
1029077880 7:97950290-97950312 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1029158148 7:98531946-98531968 GCCCTCTGCTCCCACTCCCTTGG - Intergenic
1030153285 7:106427035-106427057 ACCCTGTCCGTACACTCCCAAGG + Intergenic
1033651408 7:143346419-143346441 ACCCTCTGCTCCCACTCCCTGGG - Intronic
1034544232 7:151779412-151779434 ACCCTCTCCTCCCACCCCCATGG + Intronic
1034828561 7:154289261-154289283 ACCCTGGCTGCTCACTCCCAGGG + Intronic
1035690435 8:1556260-1556282 GCTCTGTCCTCTCCCTCCCAGGG + Intronic
1036239159 8:7068060-7068082 ATCTTATGCTCTCCCTCCCAGGG + Intergenic
1036426073 8:8646089-8646111 ACCCTGTGCTGTGATTCCCCTGG - Intergenic
1036663152 8:10721346-10721368 GCCCTGTGCACTCTCTCCCGCGG - Intergenic
1036711921 8:11085287-11085309 AGCACGTGCTCTCACTCACAGGG + Intronic
1036819881 8:11931993-11932015 ACCATGTCCTCTCCCTCCCAGGG - Intergenic
1036820595 8:11936493-11936515 ATCTTATGCTCTCCCTCCCAGGG - Intergenic
1036903207 8:12687365-12687387 ACCTTGTCCTCTCCCTCCCAGGG - Intergenic
1036905707 8:12707029-12707051 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1036906660 8:12713147-12713169 ATCTTATGCTCTCCCTCCCAGGG - Intergenic
1039798675 8:40936159-40936181 ACCCCCTGCTCCCACTCCCCTGG - Intergenic
1040575914 8:48651416-48651438 AGCCTGAGCTCTCACTCCCCCGG + Intergenic
1041839663 8:62254384-62254406 ACTATGTACTCTCTCTCCCAAGG - Intronic
1048223557 8:132564654-132564676 TCCATGTGCACCCACTCCCAGGG - Intergenic
1048377369 8:133834269-133834291 ACGCTGGGCCTTCACTCCCAGGG - Intergenic
1049473975 8:142788396-142788418 GCCCTGAGCTCTGCCTCCCAAGG - Intergenic
1049553107 8:143269732-143269754 AGCCTGAGCTCTCGCTCCCTAGG + Intronic
1051116217 9:13697610-13697632 CCCTTGTGCTCACACTGCCATGG - Intergenic
1052031241 9:23631278-23631300 ACCTTGTGCCCTCACTCTAAGGG - Intergenic
1055510355 9:76990246-76990268 ACCATATGCTCTCACTTACAAGG - Intergenic
1056158828 9:83867446-83867468 ACCCAGTAATCTCACTCCTAGGG - Intronic
1056351740 9:85756466-85756488 ACCCAGTAATCTCACTCCTAGGG + Intergenic
1056866145 9:90228708-90228730 ACCTTATCCTCTCCCTCCCAGGG + Intergenic
1056916882 9:90754201-90754223 ACCTTATCCTCTCCCTCCCAGGG - Intergenic
1058426547 9:104880193-104880215 CTCCTGTGCTGTCTCTCCCAGGG - Intronic
1059437624 9:114285977-114285999 ACCTTGACCTCTCATTCCCAAGG - Intronic
1060029906 9:120205224-120205246 ACCCTGTGTTCTGCCACCCATGG + Intergenic
1060141270 9:121212441-121212463 ACCCTCTTCTCTCCCTGCCAGGG + Intronic
1061719309 9:132542059-132542081 ACCCTGTGAGCTCATGCCCAGGG + Intronic
1062269358 9:135701615-135701637 GCCCTGTGCTCTCACCCAGACGG - Intergenic
1062532102 9:137006564-137006586 ACCCAGTGCCCTCAAGCCCATGG + Intergenic
1187252528 X:17611746-17611768 ACCCTTGGCTTTCACTCCCAAGG - Intronic
1191714832 X:64187162-64187184 ACCCTGTGCTGTCAACACCATGG + Exonic
1191729965 X:64322999-64323021 ACCCTGTGCGCTCACTAGCCAGG + Intronic
1199384365 X:147206820-147206842 ATCCTGTGCTCTCACCACCTTGG - Intergenic
1199644551 X:149893725-149893747 ATCCTGTGCTCTCGTTCCCTGGG + Intergenic
1201985111 Y:19957357-19957379 ACCCTCTGTTCTCATTCACATGG - Intergenic