ID: 997237154

View in Genome Browser
Species Human (GRCh38)
Location 5:132279333-132279355
Sequence CGCGCGCGCGTGGGTGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997237154_997237160 28 Left 997237154 5:132279333-132279355 CCCCCGACACCCACGCGCGCGCG 0: 1
1: 0
2: 4
3: 18
4: 159
Right 997237160 5:132279384-132279406 CACACCAGCTTCACTGACAATGG 0: 1
1: 0
2: 4
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997237154 Original CRISPR CGCGCGCGCGTGGGTGTCGG GGG (reversed) Intronic
902282223 1:15383002-15383024 CGCGTGCGCGTGTGTGTGTGTGG - Intronic
903142316 1:21345933-21345955 CGCGCGCGCGTGTGTGTAAGAGG + Intergenic
903750188 1:25616720-25616742 GGCGCGCGCGTGGGCGTGGCCGG + Intergenic
906067182 1:42989831-42989853 CGCGCGCGTGTGTGTGTATGAGG + Intergenic
906376979 1:45303852-45303874 CGAGAGCGCGTGGGTTTCTGGGG + Intronic
906961386 1:50421322-50421344 CGCGCGCACTTGGGGGTCCGCGG + Exonic
907526483 1:55056872-55056894 CGCGCGCGCGTTGGGGGTGGGGG + Intronic
913680375 1:121184225-121184247 CGGGCGCGCGGTGGTGTTGGTGG + Exonic
914032210 1:143971876-143971898 CGGGCGCGCGGTGGTGTTGGTGG + Exonic
914157235 1:145096091-145096113 CGGGCGCGCGGTGGTGTTGGTGG - Exonic
916168471 1:161983592-161983614 TGCGCGCACGTGTGTGTAGGTGG - Exonic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
920467687 1:206202760-206202782 CGGGCGCGCGGTGGTGTTGGTGG + Exonic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922165152 1:223109148-223109170 TGCGCGCGTGTGTGTGTTGGAGG + Intergenic
923055792 1:230425566-230425588 TGCCCGCGGGTGGATGTCGGGGG - Intronic
923191710 1:231626669-231626691 CGCGCGCGCGCGCGCGTCAGGGG + Intronic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
1063593146 10:7410973-7410995 CGGGCGCGCGAGGGAGGCGGCGG - Intronic
1064384763 10:14879616-14879638 CGCGTGGGTGTGGGCGTCGGGGG + Intronic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1070800656 10:79242961-79242983 CGCGCGCGAGTGAGTGCGGGCGG + Intronic
1074088641 10:110226988-110227010 GGCGCGCGCGTGTGTGTGAGGGG + Intronic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1089533943 11:119149465-119149487 CGCGGGCCCGGGGGTGCCGGCGG + Intronic
1091399731 12:174725-174747 CCCGGGGGCGTGGGTGGCGGCGG - Exonic
1091434351 12:460960-460982 AGCGCGCGCCTGGGTGTGGACGG - Intronic
1091555211 12:1567871-1567893 TGCGCGCGTGTGCGTGTGGGTGG - Intronic
1093547843 12:20369214-20369236 CGCGCGCGCGTGGGTCGGGGCGG + Intergenic
1096674003 12:53216849-53216871 CGCGCGCGCGCGCGTGTGGTTGG + Intronic
1097895862 12:64824578-64824600 AGCGAGCGCGTGGGAGACGGAGG - Exonic
1101504147 12:105330908-105330930 CGCGCCCGCGCTGGTGGCGGTGG - Exonic
1102871205 12:116415793-116415815 TGCGCGCGCGTGTGTGTCACGGG + Intergenic
1103102292 12:118188959-118188981 CGCGCACGCGTGGGGGCCGAGGG + Intronic
1103856370 12:123973249-123973271 CGCGCGCGCGCGCGGCTCGGAGG + Exonic
1105443552 13:20434587-20434609 GGGGCGCGTGTGGGTGTGGGTGG - Intronic
1106250362 13:27977915-27977937 CGCGTGCGCGTGTGGGTGGGCGG + Exonic
1108408082 13:50124564-50124586 AGCGCGCGCGCGGGCTTCGGCGG - Intronic
1112466927 13:99652781-99652803 GGCTCTCGCCTGGGTGTCGGAGG + Intronic
1112503155 13:99957364-99957386 CGCGTGAGCGTGTGTGTGGGGGG + Intergenic
1112652609 13:101416019-101416041 TTCCTGCGCGTGGGTGTCGGGGG - Intronic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1118925495 14:70187642-70187664 CGCGCGCGCGTGTGTGTTGGGGG + Intronic
1120521513 14:85531911-85531933 CGCGCGGGCGTGCGTCTGGGTGG + Intronic
1120914745 14:89701515-89701537 CTCGCGCCCGGGGGTGTCAGTGG - Intergenic
1121101556 14:91253531-91253553 CGCGTGCGCGTGCGAGGCGGGGG - Intronic
1124192600 15:27593552-27593574 CACGCGTGCTTGGGTGTGGGTGG - Intergenic
1125270534 15:37934100-37934122 CGCGCGCGCGTGTGTGTAGGGGG - Intronic
1125333485 15:38604856-38604878 TGTGCGTGCGTGTGTGTCGGGGG + Intergenic
1128791137 15:70434706-70434728 CGCGCGCGCGCGGGTGGAGCGGG - Intergenic
1129761521 15:78131559-78131581 GGGGCGCGCGGGGGTCTCGGAGG + Intronic
1132398245 15:101489590-101489612 CGCGCCCGCGGCGGTGTCGGTGG + Exonic
1133212662 16:4272092-4272114 TGCTCGCGTGTGGGTGTTGGGGG - Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134291087 16:12903066-12903088 CGAGCGCGCGTGTGTGAAGGAGG + Intronic
1136428364 16:30183781-30183803 GGCGCGCGCGTGGGAGCCGCGGG + Intronic
1136779043 16:32885749-32885771 CGGGGGCGCGCGGGCGTCGGCGG + Intergenic
1136891575 16:33975769-33975791 CGGGGGCGCGCGGGCGTCGGCGG - Intergenic
1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG + Intergenic
1139534480 16:67562909-67562931 CGGGCGGGCGTGGGGGTGGGGGG - Intronic
1141392673 16:83677771-83677793 AGAGCCCCCGTGGGTGTCGGGGG + Intronic
1141694458 16:85613105-85613127 CGCGCGCGCCTGTGTGTTTGCGG + Intronic
1203081456 16_KI270728v1_random:1147838-1147860 CGGGGGCGCGCGGGCGTCGGCGG + Intergenic
1142474548 17:181294-181316 CGGGCGCGCGGGGGCGTCCGGGG + Exonic
1144687728 17:17237164-17237186 GTCACGCGCCTGGGTGTCGGCGG - Exonic
1146126573 17:30235935-30235957 CGAGCGTGTGTGTGTGTCGGGGG - Exonic
1146601965 17:34225228-34225250 CGCGCGTGCGCGCGTGTTGGGGG - Intergenic
1146652084 17:34613197-34613219 CGCGCGCGTGTGTGTGTGTGTGG - Intronic
1147667979 17:42160643-42160665 CGCGCGCGCGTGTGTGTGTAGGG - Intronic
1152552281 17:81035615-81035637 CGCGCTCGCCTTGGCGTCGGCGG + Intronic
1152654340 17:81512995-81513017 CGAGCGCGCGGGGGTGGCGCGGG - Intronic
1153582873 18:6592983-6593005 CGCGTGTGCGTGTGTGTTGGAGG + Intergenic
1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG + Intergenic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157613799 18:48975555-48975577 CGTGCGCGCCGGGGTGGCGGCGG - Intergenic
1158427473 18:57352710-57352732 AGCGCGCGCGCGTGTGGCGGAGG - Exonic
1162742689 19:12782652-12782674 CGCGCGTGCGTGGGCGGTGGCGG + Intronic
1162954538 19:14090876-14090898 AGCGGGCGCGTGGGGGTGGGAGG - Intronic
1163126601 19:15247565-15247587 CGCGTGCGTGCGTGTGTCGGGGG + Intronic
1163631413 19:18419683-18419705 CTCGCGGGCCTGGCTGTCGGAGG - Exonic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165531902 19:36409975-36409997 TGTGCGCGCGTGTGTGTTGGAGG - Intronic
1165716189 19:38047220-38047242 TGTGCGTGCGTGTGTGTCGGCGG - Intronic
1166539662 19:43596657-43596679 CAAGCGCGCGTGGGAGGCGGGGG + Exonic
1167001200 19:46746508-46746530 CGCGCGCGCGGTGGTTGCGGCGG - Exonic
1168111053 19:54191431-54191453 CGGGAGCGCCTGGGTGTGGGGGG + Exonic
1168408018 19:56120859-56120881 CGCGCGCGTGCGCGTGGCGGGGG - Intronic
932231398 2:70087040-70087062 CGCGTGCGCGAGGGTGTGGGGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
937950853 2:127387380-127387402 TGTGCGCGCGTGTGTGTCGGGGG - Intronic
939012939 2:136868100-136868122 TGCGCGCGCGTGTGTGTGTGTGG - Intronic
942748762 2:179264777-179264799 CGCGCGCGCCCGGGTGACGGCGG + Exonic
944766649 2:202871480-202871502 CGCGCGCGCGCGCGTGTGGCCGG + Intronic
945649266 2:212538617-212538639 CGGGCGCGCGTGGGGGTGCGAGG + Exonic
945699432 2:213151795-213151817 TGCGCGCGCGTGCGTGTGTGCGG + Intronic
947049880 2:226030633-226030655 AGCGCGCGCCTGTGTGTGGGGGG + Intergenic
947693900 2:232166326-232166348 CGCGCACGCGTGTGTGTGTGTGG - Intronic
948645266 2:239400549-239400571 CGCGCGGCCGTGGGAGGCGGGGG - Exonic
1169113223 20:3046306-3046328 CCCGCGCGCGCTGGTGACGGTGG + Intronic
1172776887 20:37413111-37413133 CGCGCGCGCGCGTGTGTGTGTGG + Intergenic
1173167085 20:40692899-40692921 TGCGCGCGCGTGTGTGTTGGTGG + Intergenic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176207180 20:63895386-63895408 CGGGCGCGGGTGGGGGGCGGGGG + Intronic
1176548432 21:8211785-8211807 CCCGACGGCGTGGGTGTCGGCGG + Intergenic
1176550497 21:8218950-8218972 CGCGCGCGCGTGCGTGCGGGGGG + Intergenic
1176567363 21:8394820-8394842 CCCGACGGCGTGGGTGTCGGCGG + Intergenic
1176569427 21:8401989-8402011 CGCGCGCGCGCGCGTGCGGGGGG + Intergenic
1176577339 21:8446220-8446242 CGCGCGCGCGTGCGTGCGGGGGG + Intergenic
1178535104 21:33404015-33404037 CGCGGGCGCGCGGGTGGGGGAGG - Intronic
1178610367 21:34073932-34073954 CGCGTGCGCGCGGGAGGCGGGGG + Intronic
1179411631 21:41167681-41167703 CCCGCGCGCTTGGGGGTCCGCGG - Intergenic
1179718478 21:43302268-43302290 CTCGGGCCTGTGGGTGTCGGTGG - Intergenic
1181514389 22:23402724-23402746 CGCGGGCGCGAGGGGGGCGGAGG + Intergenic
1184127969 22:42500956-42500978 GGCGTGCGCGTGGGTGTCGGGGG + Intergenic
1184136759 22:42554272-42554294 AGCGTGCGCGTGGGTGTCGGGGG + Intronic
1184198648 22:42949444-42949466 TGCGCGCGCGTGTGTGTATGAGG - Intronic
1184523826 22:45009940-45009962 CGCGCGCGCCTGGATCTCGTTGG + Intronic
1184604221 22:45562995-45563017 CGCGGGCGCTTGGATGTTGGTGG - Intronic
1184766870 22:46576862-46576884 CGCGTGCGCGTGGGTGCGAGCGG + Intronic
1203255394 22_KI270733v1_random:135291-135313 CGCGCGCGCGTGCGTGCGGGGGG + Intergenic
956761331 3:72447307-72447329 GGGGCGCGCGTGCCTGTCGGTGG + Intergenic
960281248 3:115783981-115784003 CGTGTGCGCGCGCGTGTCGGGGG + Intergenic
961376514 3:126469679-126469701 CACGTGCGTGTGGGTGTTGGAGG - Intronic
961536681 3:127575143-127575165 CGCCCCCGCGTGGCTGCCGGCGG - Intronic
967118497 3:186362323-186362345 CGCGCGCGCGCCGGTGTGTGTGG - Intergenic
967889133 3:194352496-194352518 TGCGTGCGTGTGGGTGTGGGGGG + Intergenic
968086539 3:195876544-195876566 GGAGCGGGCCTGGGTGTCGGTGG - Intronic
970793444 4:19887452-19887474 AGCGAGCGCCTGGGTGTAGGTGG - Intergenic
974047126 4:56907833-56907855 CGGGCGCGCGCGGGCGTCGGAGG + Intergenic
978159401 4:105527439-105527461 CGGGCTCGGGTGGGTGTTGGTGG - Intergenic
978618546 4:110618771-110618793 TGCGCTAGCGTGTGTGTCGGGGG - Intronic
982584502 4:157220675-157220697 CGCGCGCGCGTGAGTGAGAGAGG + Intronic
984167448 4:176319911-176319933 CGCGCGCGCGCTCGCGTCGGAGG + Intergenic
986748041 5:10761181-10761203 CGCGCGCGCGTGGGGCGCCGGGG + Exonic
987258238 5:16179390-16179412 GGCGCGCTCGGGGGTCTCGGGGG + Exonic
989033990 5:37150506-37150528 TGTGCGCGCGTGTGTGTTGGGGG - Intronic
990210781 5:53480176-53480198 CGCGCGCGCGCGAGTGTGAGAGG - Intergenic
990753207 5:59039800-59039822 GGCGCGAGCGTGTGTGTCTGTGG + Intronic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
997237154 5:132279333-132279355 CGCGCGCGCGTGGGTGTCGGGGG - Intronic
998131266 5:139652142-139652164 CGCGCGCGCGCGCGCGCCGGCGG - Intronic
999371740 5:151059874-151059896 CGCGCGCGCATGCGTGTAAGTGG + Intronic
1007800455 6:44387923-44387945 CGCACGCGCGCGGAGGTCGGGGG + Intronic
1008369181 6:50714126-50714148 AGCGCGCGTGTGTGTGGCGGCGG + Intronic
1013112073 6:107072119-107072141 TGAGCGCTGGTGGGTGTCGGGGG + Intronic
1014635957 6:123846820-123846842 CGCGTGCGTGTGTGTGGCGGTGG - Intronic
1015691727 6:135931931-135931953 CGCGCGCGTGTGTGTGTGCGCGG - Intronic
1018774126 6:166998584-166998606 CGCCGGCGCCTGGCTGTCGGCGG + Intergenic
1018876751 6:167827532-167827554 CGCGCTCGCGGGGGTGGGGGCGG - Intronic
1019619445 7:1983126-1983148 CGCGCGCGCGCGCGCGTCTGTGG - Intronic
1019626538 7:2018762-2018784 CGGGCGGGAGTGGGTGGCGGAGG - Intronic
1020201213 7:6081529-6081551 GGCGCGCGCGTGGGTGGGGCGGG - Intergenic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1025078664 7:55964460-55964482 CGCGCGGCCGCGGGGGTCGGCGG - Intronic
1028160110 7:87475731-87475753 CGGACGCGCGTGGGGGGCGGGGG - Exonic
1030348155 7:108456029-108456051 GGCGCCCGCGGGAGTGTCGGGGG + Intronic
1031213278 7:118858658-118858680 CGCGCGCGCGTGGGACTGGCGGG - Intergenic
1033422493 7:141216454-141216476 CGCGCGCGCGTGTGTGTGTGTGG + Intronic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1036723706 8:11200999-11201021 CGCGCGGCCGAGGGCGTCGGGGG + Exonic
1037901457 8:22691742-22691764 CGCGCGCGCGCGTGTGTGTGTGG - Intronic
1038729010 8:30110380-30110402 CGTGCGCGCGTGTGTGTAGTGGG + Intronic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1039864584 8:41490288-41490310 CGAGCGCGCGGGGGTGTGAGGGG - Intergenic
1041673722 8:60517268-60517290 CGCGGCCGGGCGGGTGTCGGCGG + Intronic
1048308295 8:133298480-133298502 CGTGCGCGCGTGTGTGTCTGTGG - Intronic
1049509044 8:143018615-143018637 CGCGTGCGCGCAGGTGGCGGGGG - Intronic
1049660023 8:143815725-143815747 GGCGGCCGGGTGGGTGTCGGCGG - Intergenic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1059790035 9:117632132-117632154 CGCGCGCGCGCGTGTATTGGGGG - Intergenic
1061252891 9:129437051-129437073 CGCGCGCGCGTGCCTGACCGCGG + Intergenic
1062596490 9:137302124-137302146 CGCGCCCGGGTGGGCGACGGGGG + Exonic
1203471792 Un_GL000220v1:118426-118448 CGCGCGCGCGCGCGTGCGGGGGG + Intergenic
1185505469 X:630137-630159 CGCGGGCGCTTGGGAGGCGGCGG - Intronic
1186485630 X:9932476-9932498 GGCTCGCGCTTGGGTGGCGGTGG - Exonic
1187940012 X:24372131-24372153 CGCGCGCGCGCGTGTGTGTGTGG - Intergenic
1189325189 X:40107409-40107431 CGCGCGCGCTTGGGTGGGGGCGG - Intronic
1190096118 X:47482606-47482628 CGCGTGCGCGTGTGCGTCGAAGG + Exonic
1190418506 X:50204512-50204534 GGCGCGCGCGTGTGTGTGTGTGG + Intronic
1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG + Intronic
1197903723 X:131400812-131400834 CGCGCGCGCGTGTGTGTAATAGG - Intergenic
1199736804 X:150693346-150693368 GCCGCGCGCGCGGGGGTCGGGGG - Intronic