ID: 997241210

View in Genome Browser
Species Human (GRCh38)
Location 5:132309461-132309483
Sequence TCTTGGGCCCCTCTTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997241203_997241210 4 Left 997241203 5:132309434-132309456 CCTGTGCTGCATGATGCTGACAG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG No data
997241202_997241210 26 Left 997241202 5:132309412-132309434 CCACTGCGTGTGCATGGCTCTTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997241210 Original CRISPR TCTTGGGCCCCTCTTCAGGG AGG Intronic
No off target data available for this crispr