ID: 997242043

View in Genome Browser
Species Human (GRCh38)
Location 5:132314854-132314876
Sequence CAGTGTCTGCAGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 538}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997242032_997242043 20 Left 997242032 5:132314811-132314833 CCTTTAATTATTTGCGAAGAGCC 0: 1
1: 0
2: 2
3: 12
4: 79
Right 997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 59
4: 538
997242036_997242043 -2 Left 997242036 5:132314833-132314855 CCCGTGCCATGGGCTCAGCCTCA 0: 1
1: 1
2: 3
3: 34
4: 295
Right 997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 59
4: 538
997242037_997242043 -3 Left 997242037 5:132314834-132314856 CCGTGCCATGGGCTCAGCCTCAG 0: 1
1: 0
2: 4
3: 38
4: 336
Right 997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 59
4: 538
997242035_997242043 -1 Left 997242035 5:132314832-132314854 CCCCGTGCCATGGGCTCAGCCTC 0: 1
1: 0
2: 2
3: 16
4: 224
Right 997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 59
4: 538
997242038_997242043 -8 Left 997242038 5:132314839-132314861 CCATGGGCTCAGCCTCAGTGTCT 0: 1
1: 0
2: 9
3: 53
4: 400
Right 997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG 0: 1
1: 0
2: 1
3: 59
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997242043 Original CRISPR CAGTGTCTGCAGAGGGGAGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900506729 1:3033003-3033025 CTGTGTCTGCAGTGGAGGGAGGG + Intergenic
900902401 1:5526147-5526169 TGGTGTCTGCAGACGGGAGCCGG - Intergenic
901194804 1:7434354-7434376 CAGTGTCTGCCCTGGCGAGATGG - Intronic
901344512 1:8527888-8527910 AAGTGTCTTCAGAGTGGAGCTGG - Intronic
901840637 1:11952029-11952051 AAGTGTCTGTTGAGGGCAGATGG - Intronic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
903678554 1:25082149-25082171 CAGAGCCTGCAGAGGGAATATGG + Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904385482 1:30139137-30139159 CAGCGTCTGCAGTGTGGCGAGGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904978887 1:34479994-34480016 TAGTGCAGGCAGAGGGGAGAAGG + Intergenic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905091971 1:35437059-35437081 CAGTGTCTACCGAAGGGAGCTGG - Intronic
905203510 1:36329636-36329658 CAGCGTTTGAACAGGGGAGACGG + Intergenic
905366721 1:37455607-37455629 AAGTTTCTGCAGGGGGGTGAGGG + Intergenic
905710899 1:40101998-40102020 GCTTGTCTGAAGAGGGGAGAGGG - Intergenic
905861917 1:41357715-41357737 GAGTGTCTGCAGAAGCCAGAGGG - Intergenic
905913962 1:41672328-41672350 CAGTGGCTGCAGCGGTCAGAAGG - Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906209618 1:44005212-44005234 CAGGGACCGCAGAGGTGAGAAGG + Intronic
906955621 1:50371391-50371413 CAAAGTCTGAGGAGGGGAGAAGG - Intergenic
907300490 1:53483791-53483813 CAGCCTCTGCAGAGGTGGGAGGG + Intergenic
907318814 1:53589808-53589830 CAGTGTCTGCTCAGGGGGCATGG - Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
908451627 1:64261741-64261763 CAGAGATTGCAGAGGGGAGTAGG - Intronic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
908879822 1:68718697-68718719 CAGTGCCTGCTGTGGGGTGAAGG - Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
910188892 1:84574632-84574654 CAGTGTCTGCGGCGCCGAGAGGG + Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910465441 1:87494171-87494193 CAGTGTCTGCAGAGAGGTGCAGG + Intergenic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911461923 1:98202364-98202386 CAGTGTCAGCATGGGGGAAAAGG - Intergenic
911846940 1:102765616-102765638 CATTCTCTGAAGAGGGGAGAGGG + Intergenic
912927818 1:113929375-113929397 CAGAGTCTGCAGTGCGGAGGGGG + Intronic
913452789 1:119003492-119003514 CAGTTGCTGCAGGGGAGAGAAGG - Intergenic
914290810 1:146271345-146271367 CTAAGTCTGCTGAGGGGAGAGGG - Intergenic
914360254 1:146929265-146929287 CAGTGTCTGTAGAGAGGTGCAGG + Intergenic
914493494 1:148170632-148170654 CAGTGTCTGTAGAGAGGTGCAGG - Intergenic
914551854 1:148722128-148722150 CTAAGTCTGCTGAGGGGAGAGGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915310137 1:155002467-155002489 CAGTCCCTGCAGAGCGCAGATGG - Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
915676008 1:157531813-157531835 CAGAGACTGGGGAGGGGAGAGGG + Intronic
915709440 1:157880681-157880703 GAATGTCTGTATAGGGGAGAGGG + Intronic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
917618369 1:176769209-176769231 CAGTGTCAGCAGCCTGGAGAGGG - Intronic
917635195 1:176929140-176929162 CAGTGGCTGGAGAGGTGAGAGGG + Intronic
918115724 1:181495690-181495712 CAGTGTCTTCAGATGTGAGGTGG + Intronic
919685413 1:200479525-200479547 CAGTGTGTGCAGAGGGGCTGGGG - Intergenic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922711904 1:227840595-227840617 CAGTGGCTGCAGAGCTGAGATGG + Intronic
922982407 1:229838758-229838780 CATTGTTTCCAGAGGGGCGAGGG - Intergenic
923380364 1:233411325-233411347 TGGAGTCTGCAGAGGGCAGAAGG - Intergenic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
923942109 1:238839741-238839763 CAGTTTCTGCAGATGGGATTGGG + Intergenic
924458108 1:244234264-244234286 CAGAGTCTGCAGATAGGCGACGG - Intergenic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1064185763 10:13160804-13160826 CAGTGTCTGCAAGGAGGAAAAGG + Intergenic
1065126722 10:22580945-22580967 AAGTGTCTGCAGACAGGAGTTGG - Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065861436 10:29875737-29875759 CAGTTTCAGTAGAGGGGTGAGGG - Intergenic
1066502003 10:36003605-36003627 GAGTGTTTGGAGAGGGGACAGGG - Intergenic
1067139918 10:43648507-43648529 CAGCGTCTGCGGAGAGGAGCAGG - Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070355968 10:75640636-75640658 CAGAGGCTGCAGATGGGAGAGGG - Intronic
1070800278 10:79241288-79241310 GAGGATCTGCAGTGGGGAGATGG + Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071467360 10:85953584-85953606 CAGATTCTGCAAAGTGGAGAAGG - Intronic
1071513372 10:86281355-86281377 CAGTGGCTGCAGAGGGGTTATGG + Intronic
1073048872 10:100655305-100655327 CAGCGCCGGGAGAGGGGAGAGGG - Intergenic
1073208525 10:101781098-101781120 CAGTCTCTGCAGGTGGGAGAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1075341226 10:121648236-121648258 CAGTGACTGCAGAGGAGGGATGG - Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1076058738 10:127396457-127396479 CAGTGGCTGGACAGGGGAGTTGG - Intronic
1076499609 10:130927090-130927112 CAGTCTCTGAAGAATGGAGATGG + Intergenic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1077782154 11:5342828-5342850 CATTGCCTCCAGAGAGGAGAGGG - Exonic
1081208690 11:40305159-40305181 CAGTGCCTGCAAAGAGCAGAGGG - Intronic
1081465142 11:43309423-43309445 CCGTGACTGCAGAGTGGAGGTGG - Intergenic
1081521442 11:43885692-43885714 CAGTGTCTGCACATAGCAGATGG - Intronic
1081548217 11:44087662-44087684 CAGTGTATGTGGTGGGGAGAGGG + Intergenic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1082901279 11:58255971-58255993 CTGTGTCTGCAGCAGTGAGAGGG + Intergenic
1083265821 11:61546477-61546499 CGGAGCCTGCAGAGGAGAGAGGG + Intronic
1083593973 11:63910333-63910355 CAGTGTCTCCTGAGAGGAGGGGG - Exonic
1084335493 11:68455355-68455377 CTGTCACTGCAGAGGTGAGAGGG - Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085602473 11:77867715-77867737 CTGTGTCAGCAAAGGGGATATGG - Intronic
1086162363 11:83736293-83736315 CAGTGTCCTCATAGGGGAAAAGG + Intronic
1087660102 11:100977302-100977324 CAGTCTCTTCAGCGGAGAGATGG - Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088770245 11:113028031-113028053 CAGAGGCTGGAGAGGGGAAAGGG + Intronic
1089027836 11:115290161-115290183 CAGTGTCTGCAGAGGCCTGGTGG + Intronic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089318520 11:117608843-117608865 CAATGTCAGCAAAGGTGAGAAGG - Intronic
1090653422 11:128825255-128825277 CAGTGGCTCCAGAGAGGTGAGGG - Intergenic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1091301839 11:134512926-134512948 CAGTGTCTGCTGGGGTGAGTCGG - Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091338482 11:134792306-134792328 CAGCTTCTGCAGAGGGCAGGAGG - Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091452438 12:581634-581656 CAGGGTCTGCTCTGGGGAGAAGG + Intronic
1091661570 12:2387808-2387830 GAGTGACAGCAGAGGGGCGAGGG + Intronic
1091770463 12:3147986-3148008 GAGGGTCTGGATAGGGGAGAAGG + Intronic
1092731420 12:11538596-11538618 CAGGCACTGCAGAGGGGAGCCGG - Intergenic
1093399508 12:18727469-18727491 CTGAGTCTTCAGAGGTGAGAAGG + Intronic
1093953860 12:25194848-25194870 CAGTTTCTGCAAACGGGAGATGG - Intronic
1094053126 12:26242371-26242393 TAATGTTTGCAGAGGGCAGAGGG - Intronic
1096414183 12:51399330-51399352 AGGTGACTGCAGATGGGAGAAGG - Intronic
1096531231 12:52244070-52244092 AGGTGTCTGCAGTGGAGAGAGGG + Intronic
1096587341 12:52631402-52631424 CTGAGTCTGCAGAGTTGAGACGG + Intergenic
1096657978 12:53103599-53103621 CTGCGTCTGCAGAGGACAGAAGG + Exonic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1099071607 12:78051172-78051194 CATTGTGTGAAGAGGGGAGGTGG + Intronic
1099825134 12:87766452-87766474 AAGGGTCTGCAGATGGGTGAAGG - Intergenic
1101091101 12:101286681-101286703 CAGTAGCTGGAGAGGAGAGATGG - Intronic
1101987374 12:109458151-109458173 CAGGCTCTGGCGAGGGGAGATGG + Intronic
1102490301 12:113286488-113286510 GCGTGTCTGGAGAGGAGAGAGGG + Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1103428718 12:120862795-120862817 CAACCTCTGCAGAGGGGAGAGGG - Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1103917054 12:124381173-124381195 CAGTCTCTGAGGAGGGGAGAGGG - Intronic
1104081483 12:125434185-125434207 CCGTGGCTGCAGAGGTCAGAGGG - Intronic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1104913008 12:132248948-132248970 CAGGATCTGCAGAGTGGAGCGGG + Intronic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107183340 13:37487642-37487664 CAGTGACTGTAGATGGGGGATGG - Intergenic
1108116791 13:47137617-47137639 CAGTGTCTGAAGAGCAGAGCAGG - Intergenic
1108581787 13:51834122-51834144 CAGTTTGTGCAGAGAAGAGAGGG + Intergenic
1108638139 13:52356620-52356642 CAGTCTCTGGAGTAGGGAGAGGG + Intergenic
1109648764 13:65296676-65296698 CCGTGTATGGAGAGGAGAGATGG + Intergenic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113507641 13:110828143-110828165 CAGTGTCTGCTGAGGGTGTATGG + Intergenic
1113818470 13:113192936-113192958 CTGTGTCTGCACATGGTAGATGG - Intronic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114208294 14:20593959-20593981 CAGAGTCAGTAGTGGGGAGAGGG - Intronic
1115238257 14:31229077-31229099 CACTGTGTACAGAGGGGACATGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116384107 14:44309711-44309733 CAGCCTCTTCACAGGGGAGAGGG - Intergenic
1116411238 14:44626150-44626172 CATAGACTGCAGAAGGGAGAGGG + Intergenic
1116521095 14:45848082-45848104 CAGTGTCTGAAGACAGGAGAAGG + Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1117143117 14:52810013-52810035 TAGTGTCTGAAGTGGGGAGGTGG - Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1119880492 14:78095805-78095827 TAGAGCCTGCAGAGGGGACATGG - Intergenic
1119892687 14:78194727-78194749 CAGTAGTTGCAGAGGAGAGAAGG + Intergenic
1121209482 14:92197310-92197332 GAGTGACTGCAGAGGGGCAAAGG + Intergenic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121337247 14:93084991-93085013 CAGGGTCTGCAGGGGGCACAGGG - Intronic
1121560828 14:94874033-94874055 GAGGGGCTGCAGAGGGGAGCAGG - Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122328193 14:100895277-100895299 CAGGATCTGCTTAGGGGAGATGG + Intergenic
1122328205 14:100895323-100895345 CAGGGTTTGCTTAGGGGAGATGG + Intergenic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474588 14:101998208-101998230 CAGCGCCTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122970062 14:105148853-105148875 CAATGTCTGCAGAGGCGAGCGGG + Exonic
1124650413 15:31469706-31469728 CACTGGCTGCAGAAGGGAGGTGG - Intergenic
1124825046 15:33085334-33085356 CACTGTCCAAAGAGGGGAGAAGG + Intronic
1125521204 15:40348698-40348720 CAGTGCCTGCTGAGGGGTGGTGG + Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126849697 15:52789549-52789571 CAGCGGCTGCAGAGGGGTCAAGG + Exonic
1127530506 15:59839049-59839071 CAGAGGCTGCAGATGGGAGCTGG + Intergenic
1128234886 15:66060509-66060531 CAGGTACTGCAGAGAGGAGAAGG - Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129749078 15:78047796-78047818 CAGTGTCTGGAGTGGGGGGCAGG + Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131857891 15:96618012-96618034 TAGGGTCTTCAGAGGGGACAGGG + Intergenic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1132405494 15:101539807-101539829 CTGTGTCTGCAGAGGTGGAAGGG + Intergenic
1132701757 16:1225059-1225081 CAGTCTCTTCAGAGGAGACACGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1132863394 16:2082338-2082360 CCGTGCCTGCAGAGGAGAGAGGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133401683 16:5492193-5492215 CTGTATCTGCAGAGAGGAGTAGG - Intergenic
1133831528 16:9327755-9327777 GAGTTACTGCAGATGGGAGAGGG + Intergenic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134876856 16:17708121-17708143 CTTTGTCTGCAAAGGGGAGAAGG - Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135109059 16:19676363-19676385 CTCTGTCTGCAGGGGAGAGAGGG - Intronic
1135230236 16:20699478-20699500 CAGTCACTGGAGAGGTGAGAAGG + Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135392512 16:22105472-22105494 CTGTGTCTGCAGAGGATAAAAGG + Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135551208 16:23399579-23399601 ATGTGTCTGCAGGGGGGAGAGGG - Intronic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1137002625 16:35243101-35243123 CTGTGTCTGCACATGGCAGAAGG - Intergenic
1138206684 16:55130639-55130661 CAGGGCCTGCAGAGGAGAGCAGG - Intergenic
1139255627 16:65539378-65539400 CTCTGGCTGCAGAGTGGAGAGGG - Intergenic
1139339655 16:66259676-66259698 CTGTGCCAGCAGAGGCGAGAGGG + Intergenic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1139544528 16:67644078-67644100 CAGTGTCTCCAGGGCTGAGAGGG - Intergenic
1140207160 16:72942797-72942819 CAGAGTCTGCAAAGAGGAGCTGG - Intronic
1141602559 16:85135346-85135368 TGGTGTCTGCAGCGGGGGGATGG - Intergenic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1141768714 16:86075557-86075579 CAGAGTCTTCAGACAGGAGAGGG - Intergenic
1141952134 16:87346014-87346036 GAGTGGCTGCTGAGAGGAGAAGG + Intronic
1142001524 16:87667058-87667080 CAGAGGCTGCAGAGGGGGCACGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142068692 16:88077411-88077433 TACTGTCTGCACAGTGGAGAGGG - Intronic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1143003383 17:3810268-3810290 CAGTGGCTGAAGAACGGAGAGGG + Intergenic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143513391 17:7407769-7407791 AGGCGTCTGCTGAGGGGAGAAGG + Intronic
1143617964 17:8064694-8064716 CAGGGTCTGCCGTGGGGGGAAGG + Intergenic
1144058307 17:11560189-11560211 CACACCCTGCAGAGGGGAGAAGG - Exonic
1144182283 17:12763406-12763428 CTGTGTCTGCATTGGAGAGAGGG - Exonic
1144338714 17:14296010-14296032 CAGTGTCTGCCACAGGGAGATGG + Intergenic
1144421653 17:15104412-15104434 GAGTGCCTGCAGAGGGGCAATGG - Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144887828 17:18475951-18475973 GATAGGCTGCAGAGGGGAGAGGG - Intergenic
1144942552 17:18951779-18951801 CAGTATCTTCAGAGGTGAGGCGG + Intronic
1145144385 17:20468350-20468372 GATAGGCTGCAGAGGGGAGAGGG + Intergenic
1145175831 17:20699753-20699775 GATAGGCTGCAGAGGGGAGAGGG + Intergenic
1145858189 17:28182797-28182819 CAGTGTCTGCAGAAGAGATCAGG + Intronic
1145978993 17:29000679-29000701 GAGTGTCTGAAGCTGGGAGATGG + Intronic
1146808646 17:35885737-35885759 TGGTGTCTGCAGAGCGTAGAAGG - Intergenic
1147130250 17:38403431-38403453 CAGTTTCTGCAGGGAGCAGAGGG - Exonic
1147206173 17:38839177-38839199 CAGAGTCTGGGGAGGGGAAAAGG - Intronic
1147644758 17:42027052-42027074 CAGTGGCTGCGGTGGGGAGCGGG + Exonic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1147720757 17:42537917-42537939 GATTGGCTGCATAGGGGAGATGG - Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148461207 17:47840066-47840088 CAAAGTCTGCAGAGAGGAGGAGG + Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148732664 17:49846992-49847014 AAGTGTGTGCAGTGAGGAGAGGG - Intronic
1149421975 17:56520297-56520319 CAGACTCTGCTGAGGGCAGAGGG - Intergenic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1150456887 17:65313425-65313447 CAGTGTCTGCAGAGTGGGGCTGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152014262 17:77739450-77739472 CAAAGTCCGGAGAGGGGAGAGGG + Intergenic
1152022732 17:77789315-77789337 CGGGCTCTGCAGAGGGAAGAAGG - Intergenic
1152226851 17:79096752-79096774 CGGTGTCTGCTGAGGAGGGAGGG + Intronic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152845074 17:82594671-82594693 GAGTGTCTGCAGATTGGAGTAGG + Intronic
1203171106 17_GL000205v2_random:148453-148475 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1153255434 18:3165791-3165813 CCATGGCTGCAGAGGAGAGAAGG - Intronic
1153854911 18:9136524-9136546 TAGTGTCTGCGGCGGGGAGGCGG + Intronic
1153942685 18:9991256-9991278 CAGTCTCTGTGGAGGCGAGAGGG - Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1155295842 18:24384013-24384035 CAGTGGCTGCACAGAGGAGAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156406885 18:36791315-36791337 CTGTGTCTTCAGTGTGGAGATGG - Intronic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157489073 18:48109690-48109712 CAGGGCCTGCAGAGGAGGGAGGG + Intronic
1158350440 18:56559781-56559803 CAGAGGCTGCAGGTGGGAGAAGG - Intergenic
1159457434 18:68678445-68678467 CAGGGACTGCAAAGGGGAAAGGG + Intronic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1160055677 18:75477669-75477691 CAGTGTTTGCATTTGGGAGATGG - Intergenic
1160057199 18:75494196-75494218 CAGTGTCTGAAGAGTGAAAAAGG + Intergenic
1161143427 19:2662792-2662814 CAGCCTCTGGGGAGGGGAGAAGG - Intronic
1161539497 19:4841462-4841484 CAGTGACTGCTGATGGGAAAAGG + Intronic
1161570902 19:5030452-5030474 CAGAGCCTGCAGAGGGGGGTGGG + Intronic
1161734765 19:5984837-5984859 CTTTGGCTGCAGAGGAGAGAGGG - Intergenic
1161772055 19:6236242-6236264 CAGTGTCTGCAGAGCGCTGATGG + Intronic
1161999663 19:7735266-7735288 CATTCTCTGCAGAGATGAGAGGG + Intergenic
1162006455 19:7783479-7783501 CATTCTCTGCAGAGATGAGAGGG - Intergenic
1162061040 19:8095498-8095520 CAAAATCTGTAGAGGGGAGATGG + Exonic
1162430866 19:10627643-10627665 GGGTGTTTGCAGAGGGCAGATGG + Intronic
1162856807 19:13474854-13474876 TAGTGTCTGCTAAGGGGTGAAGG - Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165043922 19:33089309-33089331 CAGTGTCTGAAGAGGGCACCTGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
1166800786 19:45455858-45455880 GAGTGTCTGCAGGAGGGAGAGGG + Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167767506 19:51493440-51493462 TATAGTCAGCAGAGGGGAGAGGG - Intronic
1168149084 19:54435482-54435504 CAGTGTGTGCCGATGGGGGAGGG + Intronic
1168327566 19:55546027-55546049 CAGTGTGCGGACAGGGGAGAGGG - Intergenic
1168494009 19:56835429-56835451 TAGTCTCAGCAGAGGGGATAGGG - Intronic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925886634 2:8399302-8399324 AAGTGTCTGAAGAGGGCAAATGG - Intergenic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
926526531 2:13988292-13988314 AATTGACTGCAGAGGGGATAAGG - Intergenic
927867309 2:26598444-26598466 CAGAGGCTGCAGAAGAGAGAAGG + Intronic
928182184 2:29076139-29076161 CACTGTCTGCAGGAGGGAGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929591487 2:43150444-43150466 CAGTGTCTGCCTGGGTGAGAGGG + Intergenic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931143146 2:59485792-59485814 AAATGTCTGCAGATGGGAGGAGG - Intergenic
932054321 2:68429508-68429530 CAACCTCTGGAGAGGGGAGAAGG + Intergenic
932429067 2:71663147-71663169 CAGTGTCTGGGCTGGGGAGAGGG + Intronic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
934118946 2:88822155-88822177 CAGTGCCTGCAGAGGGGTCCCGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
936017773 2:108972609-108972631 AAGTGTCTGCACAAGGGTGACGG + Intronic
938394417 2:130932060-130932082 CAGGGTCTGGGGAGGGGAAATGG - Intronic
938758045 2:134398506-134398528 GTGTGTCTGCAGTGGGGAGCAGG + Intronic
939866954 2:147483443-147483465 CAGTGTCTGCAAAGCTGAGCTGG + Intergenic
940796807 2:158089154-158089176 CAGTGGCTGCTGGGGGGATAGGG + Intronic
941041552 2:160629037-160629059 CAGTCTCAGCTGAGGTGAGAGGG - Intergenic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
944314848 2:198273177-198273199 CTGTGTCTGCGGAGGCGGGATGG + Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945811802 2:214558019-214558041 CAATGTCTGCGGAGTGGTGAAGG - Intronic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948127856 2:235577950-235577972 CAGTGTCTGCACAGGGGGTCTGG + Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1169607409 20:7338116-7338138 CAATCTCTGAAGAGGGGAGTGGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170816693 20:19720311-19720333 CAATGCCTCCAGAGGGGAGAGGG - Intronic
1171173515 20:23035159-23035181 CAGAGTCGGCAGCGGGGAGGGGG + Intergenic
1171206217 20:23283316-23283338 GAGTTGCTGCAGAGGAGAGATGG + Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1176129498 20:63490730-63490752 CAATGCCTGCAGAGGGGAGGGGG + Exonic
1176327090 21:5510284-5510306 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176330622 21:5545927-5545949 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176397135 21:6275024-6275046 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176400667 21:6310667-6310689 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176436490 21:6678437-6678459 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176440022 21:6714080-6714102 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176460752 21:7005507-7005529 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176464284 21:7041149-7041171 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1176484313 21:7387285-7387307 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1176487845 21:7422928-7422950 CCGTGTCTGCAGAGGGACTAGGG - Intergenic
1177498624 21:21920853-21920875 CAGAGTGTGCAGAGAAGAGAGGG + Intergenic
1178672341 21:34603028-34603050 CAGTTTCTGCTGGAGGGAGAGGG + Intronic
1179288466 21:39997866-39997888 CAGTCTCAGCAGGGGAGAGACGG + Intergenic
1180604244 22:17044536-17044558 CAGTGTCTGGACAGATGAGAGGG - Intergenic
1180825368 22:18857610-18857632 CTGTGTCTGCAGAGTTGATAGGG + Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181187363 22:21116937-21116959 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1181211835 22:21293556-21293578 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181397665 22:22633330-22633352 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181500413 22:23312700-23312722 CTGTGTCTGCAGAGTTGATAGGG - Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181628314 22:24136090-24136112 CAGTTTCTGCTGTGGGGAGGTGG - Intronic
1181651740 22:24262728-24262750 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
1181705635 22:24648011-24648033 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182243879 22:28939644-28939666 CAGTACTTGCAGAGGAGAGACGG - Intronic
1182357583 22:29729277-29729299 GAGAGTCTGCAGAGGGGGGCTGG + Intronic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1182795666 22:32989880-32989902 CTGTGTCTTTAGAGAGGAGAGGG - Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184384168 22:44164858-44164880 CGGTGGCTGCAGTGGGTAGATGG - Intronic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185227119 22:49659518-49659540 CAGTGGCTGCAGAGACGAGGGGG + Intergenic
1203215118 22_KI270731v1_random:1876-1898 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1203275515 22_KI270734v1_random:83513-83535 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
950567992 3:13782597-13782619 CAGTGACTGCAGGAGGGTGAAGG - Intergenic
952843551 3:37668133-37668155 CAGTGTCTGCTCAGGAGGGAAGG - Intronic
953099420 3:39810082-39810104 CAGCCTCTGCGGAGGGGCGAGGG + Intronic
953350517 3:42212016-42212038 AACTGGCTTCAGAGGGGAGAGGG + Intronic
953371033 3:42388712-42388734 GAGTGTCTGCATAGATGAGATGG + Intergenic
953409485 3:42682291-42682313 CAGTTACTGAAGTGGGGAGATGG + Intergenic
953461202 3:43082497-43082519 CAGTGTGTGTATATGGGAGAGGG - Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956062440 3:65361216-65361238 CTGTTTCTGAAGCGGGGAGACGG - Exonic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
958052242 3:88363121-88363143 CACTGCCTGCAGAGTGGGGATGG + Intergenic
958685902 3:97393734-97393756 CAGAGTCTGAAGAGGGTAGTGGG - Intronic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
959858509 3:111189922-111189944 CAGTCACTGGAGAGGGGACAGGG + Intronic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
960989757 3:123302876-123302898 CAGTGTCTGCACTGGGAACAAGG - Intronic
960990803 3:123309962-123309984 CAGTGACTGCAGAGCAGACAGGG + Intronic
961061461 3:123832290-123832312 AAGTGTCTGAAGGGAGGAGAAGG - Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964695468 3:159503011-159503033 CAGTGTCTCCTGGGGAGAGAAGG - Intronic
965506546 3:169521547-169521569 TAGTGTCTCCAGAGGTGTGAAGG + Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
966966677 3:185001668-185001690 CAACCTGTGCAGAGGGGAGAGGG - Intronic
967120522 3:186378658-186378680 AAGTGACTGCAGAGATGAGAAGG + Intergenic
967184355 3:186931962-186931984 CACGATCTGCAGCGGGGAGATGG + Intronic
968557656 4:1255696-1255718 CAGTGGTTGCACTGGGGAGAAGG - Intergenic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968827432 4:2909494-2909516 CAATGCCTGAAGAGAGGAGACGG - Intronic
969056442 4:4405661-4405683 CAGAGTCTGCACAGGGCAGGGGG + Intronic
969610104 4:8223010-8223032 CAGGGGCTGCAGAAGGGAAAGGG - Intronic
972165584 4:36280472-36280494 TGGTGGCTGCAGAGTGGAGAGGG - Intergenic
972945451 4:44248850-44248872 CAGGTTCTCCAGAGGGGAGGAGG - Intronic
973748523 4:53988136-53988158 CAGTGACTGAAGAGTGGACAAGG + Intronic
974525663 4:63047116-63047138 CCGTGTCTTCAAATGGGAGAAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
975931022 4:79522735-79522757 CAGAGCCTGGAGAGGGGAGAAGG + Intergenic
978103327 4:104870763-104870785 CAGGGTCTGCAACGGAGAGAGGG + Intergenic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
981015433 4:139969186-139969208 GAGGGTCTGCAAAGGGGAGAAGG - Intronic
981232417 4:142372267-142372289 CAGAGTCTGGGAAGGGGAGATGG + Intronic
981584524 4:146286602-146286624 CCGTGTCTGGAGTGGTGAGAAGG + Intronic
981584528 4:146286626-146286648 CCGTGTCTGGAGTGGTGAGAAGG + Intronic
981584532 4:146286650-146286672 CCGTGTCTGGAGTGGTGAGAAGG + Intronic
981584540 4:146286698-146286720 CTGTGTCTGGAGTGGTGAGAAGG + Intronic
981584592 4:146287126-146287148 CCGTGTCTGGAGTGGTGAGAAGG + Intronic
981584596 4:146287150-146287172 CCGTGTCTGGAGTGGTGAGAAGG + Intronic
984923320 4:184784895-184784917 CAGTCTCTGTAAATGGGAGAGGG - Intronic
985521598 5:376309-376331 CAGTTTCTGCAGAGCAGAGCGGG + Intronic
985852587 5:2399570-2399592 GGGACTCTGCAGAGGGGAGATGG - Intergenic
986666931 5:10112685-10112707 CTGTGTCTGCACATGGTAGAAGG + Intergenic
987603433 5:20102661-20102683 TAGTGTCTGCAGAGGGTCAAAGG - Intronic
988149228 5:27354280-27354302 CAGTGGCTGCTGAGGCTAGAAGG + Intergenic
988893805 5:35650291-35650313 GAGTTTCTGCAGAGGGTAGGAGG - Intronic
989381140 5:40810545-40810567 CAACCTCTGGAGAGGGGAGAGGG - Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990925228 5:61014159-61014181 CAATCTCTGGAGAGGGGAGAGGG + Intronic
991400351 5:66245217-66245239 CAGGGTCTGCACAGGGGACAAGG + Intergenic
991520410 5:67490861-67490883 CACTGTCTGGAGTTGGGAGATGG - Intergenic
992436901 5:76763177-76763199 CATGAGCTGCAGAGGGGAGAAGG - Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994626463 5:102226252-102226274 CAGTGTCTGCCAAGAGAAGATGG - Intergenic
996332374 5:122344492-122344514 CAATGCCTTCAGAGAGGAGAGGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
997673460 5:135695180-135695202 CAGTCTCTGAAGAGGGGACTTGG - Intergenic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
999551877 5:152696628-152696650 CAGAGGCTGGAAAGGGGAGAGGG - Intergenic
1001138661 5:169124432-169124454 CAGTGTCTGCCCAGAGGAAAGGG - Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001428065 5:171637550-171637572 GAGTGTCTCCAGTAGGGAGAGGG + Intergenic
1001968946 5:175938298-175938320 CAGTTTCTGCAGTGGGGAAATGG + Intronic
1002248498 5:177905447-177905469 CAGTTTCTGCAGTGGGGAAATGG - Intergenic
1002454552 5:179338766-179338788 CTCTGGCTGCAGAGTGGAGAAGG + Intronic
1002719836 5:181251760-181251782 CAGGGTCTGAGGAGAGGAGATGG - Intergenic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1002826903 6:782203-782225 AGGTGTTTGCAGAGGAGAGAAGG + Intergenic
1003059368 6:2850872-2850894 CGACCTCTGCAGAGGGGAGAGGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1004515983 6:16322661-16322683 AAGGCACTGCAGAGGGGAGAAGG + Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004601037 6:17150197-17150219 TATTCTCTGGAGAGGGGAGAAGG - Intergenic
1005108017 6:22246417-22246439 GTGTGTCTGTAGAGTGGAGAAGG + Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1007071667 6:39042633-39042655 TAGTGTCAGAAGTGGGGAGAAGG - Intergenic
1007075031 6:39060856-39060878 GAGTGTGTGCATTGGGGAGAAGG + Intronic
1007249002 6:40482945-40482967 CAGTGGCTGCAGCAGGGACAGGG - Intronic
1009808807 6:68635428-68635450 CAGTACCTGCAGGGGGGAGGAGG + Exonic
1009928440 6:70148178-70148200 CGTTCTCTGAAGAGGGGAGAGGG - Intronic
1010062263 6:71636394-71636416 CAGTGACTGCAGAGGCCACAGGG - Intergenic
1010248962 6:73688653-73688675 CATCCTCTGGAGAGGGGAGAAGG + Intergenic
1011662785 6:89608713-89608735 GAGGGACTGGAGAGGGGAGACGG - Intronic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012809777 6:103942421-103942443 CAGTGTCTTTAGAAGAGAGATGG + Intergenic
1012920975 6:105220911-105220933 CAGAGTGTGCAGTGGGGAAAGGG - Intergenic
1013196463 6:107848727-107848749 TAATGCCTGCAGAGGGGAGTCGG - Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1018423269 6:163658443-163658465 CACTGTCAGCAGCAGGGAGAAGG - Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019161213 6:170068029-170068051 CTGTCTCTGCAGATGGGACAGGG + Intergenic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1019640477 7:2100901-2100923 GCGTGTCTGCAGAGTGGAGGTGG - Intronic
1019873393 7:3788398-3788420 GAGTCTGTGCAGAGGGGATAAGG + Intronic
1022088231 7:27089237-27089259 CAGTGTTTGAAGAGGTGAGCTGG - Intergenic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1023216818 7:37871277-37871299 CAGTGGCTGCAGAAGGGTGGGGG + Intronic
1026595417 7:71730620-71730642 CAGTGTCAGGAGAGGTGACATGG + Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028995278 7:97093255-97093277 AAGTGTCTTCAGAAGGGTGAGGG + Intergenic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1031146492 7:118002801-118002823 CAGTGCCTACAGAAGGGAGTTGG + Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036089828 8:5653404-5653426 CAGTGTCTGAGGAAAGGAGAGGG + Intergenic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1040548581 8:48421157-48421179 CAGTCTCTGCAGAGGGGTTCTGG + Intergenic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1044813280 8:96085716-96085738 CAGTGGCTGCAGTGCAGAGAAGG - Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045553157 8:103190756-103190778 GAGTGTCTGCAGGGTGAAGATGG + Intronic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048748491 8:137643509-137643531 CAGTGCCTCCAGAGTGGATAAGG + Intergenic
1048914711 8:139171032-139171054 CAGTGTCTGCAGGAGCCAGAAGG - Intergenic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049398867 8:142415894-142415916 CAGTGGCTGCAGGGAGGTGAGGG + Intergenic
1049428585 8:142548963-142548985 CAGAGTCTGCTGAGGGGAACAGG - Intergenic
1049599397 8:143500032-143500054 GAGTGTTTGCAGAGAGGATAGGG - Intronic
1052884785 9:33634208-33634230 CGGTGTCTCCCGAGAGGAGAAGG + Intergenic
1052943953 9:34152502-34152524 CATTTTCTGGAGAGGAGAGAGGG + Intergenic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056179126 9:84064543-84064565 CAGTTTCTGGTGAGGGCAGATGG + Intergenic
1056722880 9:89086652-89086674 TAATCTCTGGAGAGGGGAGAAGG - Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1057327372 9:94077757-94077779 CAGCTTCTGGGGAGGGGAGAGGG - Intronic
1057371620 9:94479542-94479564 CACTGCCTGCAGCGGGGAGCGGG + Intergenic
1058526018 9:105858457-105858479 CTATGACTGCAGAGTGGAGAAGG - Intergenic
1058740779 9:107940034-107940056 CATTGTCTGAAGAGTAGAGAAGG - Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1059745386 9:117195442-117195464 GAGTGGCTGCAGTGTGGAGAAGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060758598 9:126230063-126230085 CTCTGGCTGCAGAGTGGAGAAGG + Intergenic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1062140062 9:134951146-134951168 CTGAGTCTGCCAAGGGGAGAAGG - Intergenic
1062399992 9:136368190-136368212 CAGTGTCCGCAGTGAGGACAGGG - Intronic
1062433960 9:136538262-136538284 CAGTGGCTGCAGGGGTGGGAGGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1203431473 Un_GL000195v1:94399-94421 CCGTGTCTGCAGAGGGACTAGGG + Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186081238 X:5935460-5935482 CAGTGAATGCAGAGAGGACAGGG + Intronic
1187849760 X:23580231-23580253 CAGTGTCAGCAAAGAGGTGAGGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1190081775 X:47362305-47362327 CAGTGGCTGCATCGGGGAGGTGG - Intergenic
1190239235 X:48644491-48644513 CAGCATCTGCTGAGGGGATAAGG - Intergenic
1190315512 X:49148040-49148062 CAGTGACTGCCGAGGAGAGTGGG - Intergenic
1192165000 X:68822683-68822705 CAGTGTCTGGAGGGAGGATAGGG + Intergenic
1192570823 X:72203045-72203067 CAACCTCTGCAGAGGGGAGAGGG + Intronic
1192585263 X:72314053-72314075 GAGGGGCTGGAGAGGGGAGAGGG - Intergenic
1193413646 X:81196084-81196106 GAGTATCTGCAGAGGAGATAGGG - Intronic
1193606975 X:83581007-83581029 CAATCTCTGGAGAGGGGAGGGGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1196045079 X:111248478-111248500 GAATGTCTGAAGAGGGGAGACGG + Intronic
1199845830 X:151692653-151692675 CAAGGCTTGCAGAGGGGAGAAGG + Intergenic
1200554824 Y:4624096-4624118 CAGAGTCTGGAGAGGGTAGTGGG - Intergenic