ID: 997242205

View in Genome Browser
Species Human (GRCh38)
Location 5:132315655-132315677
Sequence CTGGCTTGACTGATCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997242205_997242209 0 Left 997242205 5:132315655-132315677 CCATGGAAGATCAGTCAAGCCAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 997242209 5:132315678-132315700 CCAGTCAGTAGGTAAGACCCTGG 0: 1
1: 0
2: 2
3: 11
4: 93
997242205_997242213 25 Left 997242205 5:132315655-132315677 CCATGGAAGATCAGTCAAGCCAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 997242213 5:132315703-132315725 GCAGCAGCCTCGCTATCAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 754
997242205_997242214 26 Left 997242205 5:132315655-132315677 CCATGGAAGATCAGTCAAGCCAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 997242214 5:132315704-132315726 CAGCAGCCTCGCTATCAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 1084
997242205_997242210 1 Left 997242205 5:132315655-132315677 CCATGGAAGATCAGTCAAGCCAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 997242210 5:132315679-132315701 CAGTCAGTAGGTAAGACCCTGGG 0: 1
1: 1
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997242205 Original CRISPR CTGGCTTGACTGATCTTCCA TGG (reversed) Intronic
902983519 1:20141853-20141875 CTGGCCTGCCTGATCTCTCATGG + Intronic
905847905 1:41248560-41248582 CTGGCTAGGAGGATCTTCCAAGG - Intergenic
906417790 1:45634893-45634915 CTGGCTTGCCACATCTTCCTTGG - Intronic
906710941 1:47929635-47929657 CTGGCTAGACTGCACTCCCAGGG + Intronic
908091698 1:60692713-60692735 CTGGCTTGTCTCAACTTCCTGGG + Intergenic
909404203 1:75268228-75268250 CTGGCTTGAGTGCTCTTCCCAGG + Intronic
909857946 1:80563446-80563468 CAGGCTTGACTGATCTGTTATGG - Intergenic
910254423 1:85233546-85233568 CTTGCTTGACTGCTCTTGCTAGG + Intergenic
912528635 1:110304033-110304055 CAAGCATGACAGATCTTCCAAGG + Intergenic
913261481 1:117002135-117002157 CTGGCTTTACTCATCTTCCTGGG + Intronic
913446417 1:118955132-118955154 GTGGGCTAACTGATCTTCCATGG - Intronic
915233469 1:154463550-154463572 CTGGAGTAACTGATCTTCCATGG + Intronic
917482606 1:175424920-175424942 CTGGCTTGAGTCACCCTCCAGGG - Intronic
921367977 1:214392778-214392800 CTGGCTTGAAAGAGCCTCCACGG + Intronic
1064275614 10:13902528-13902550 CTATTTTGACTGGTCTTCCAGGG - Intronic
1064412234 10:15116142-15116164 CTGTCTTGATGGATATTCCATGG - Intronic
1066757881 10:38729250-38729272 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
1067296453 10:44977674-44977696 CTGGCTTGGCTGCTTTTCCTGGG + Exonic
1067993571 10:51243360-51243382 CTGGCTTCACAGCTATTCCAGGG - Intronic
1074221367 10:111441506-111441528 CTAGCTTAACTGATCTCCCCAGG - Intergenic
1074698494 10:116072440-116072462 CTGGCTTGACTGATATGCCACGG + Intronic
1074945959 10:118280856-118280878 CAGGCTTCACCGATCTTCCCAGG + Intergenic
1079717035 11:23760855-23760877 CTGGCTTGTTTCATTTTCCAGGG - Intergenic
1084043246 11:66554858-66554880 CTGGCTGGAATGGCCTTCCAGGG - Intronic
1084085121 11:66851454-66851476 CTGGCCTAGCTGATCCTCCAGGG - Intronic
1088587765 11:111375132-111375154 CAGGCTTGACTGATTTTCTTTGG - Intronic
1089167056 11:116485446-116485468 CTGGCTTCACTGATGCTACAAGG - Intergenic
1090071236 11:123546288-123546310 TTGGCTTGACAGAGCTCCCAAGG - Intronic
1091076455 11:132622610-132622632 CTGGCTGGACTGGACTTCCAGGG - Intronic
1091314211 11:134599583-134599605 CTAGGTTGACTGCTCTTCCCAGG - Intergenic
1092699294 12:11209325-11209347 CTGGCTTGCCTGATTGTGCAGGG - Intergenic
1094793426 12:33941369-33941391 CTGTTTTGACTGATATTCCAGGG + Intergenic
1095104702 12:38218119-38218141 CTGTTTTGACTGATTTTCCAGGG + Intergenic
1098367545 12:69720467-69720489 CTGCCTTTACTGAGCTCCCAGGG - Intergenic
1102405235 12:112667765-112667787 CTGACTTCAGTGATCCTCCAAGG - Intronic
1104592872 12:130098736-130098758 TTGGCTTGGCTGCTGTTCCAGGG - Intergenic
1104754081 12:131258215-131258237 CTGTCTGGACTGTTCTTCCCTGG - Intergenic
1105813761 13:24015667-24015689 CTGGCTGGTCTGACCTTCTAGGG - Intronic
1108608962 13:52065183-52065205 CTGACTTGATTTACCTTCCAAGG - Exonic
1113076463 13:106472322-106472344 CTGCCTTGACTCATCCTCCTGGG + Intergenic
1115162500 14:30411698-30411720 CTGGCTGGACAGCTCTTTCAAGG - Intergenic
1119499710 14:75114248-75114270 CTGGCTAGAGTCAACTTCCATGG + Exonic
1122907977 14:104811077-104811099 CTGGGTGGACTGATCCCCCATGG + Intergenic
1124641647 15:31399801-31399823 CTGTCTTGCCCGATCTGCCAGGG + Intronic
1127827475 15:62717758-62717780 CTGTCTTTACTGAACTACCAGGG - Intronic
1131890899 15:96970448-96970470 CTGGCTGGTCTTATCTTCCCTGG - Intergenic
1133563507 16:6971328-6971350 CTGCCTGGATTGCTCTTCCATGG - Intronic
1136186962 16:28593953-28593975 CAGACTTGTCTCATCTTCCACGG - Intronic
1136724987 16:32349978-32350000 CAGGGTTGACTGAGCTTTCAGGG + Intergenic
1136843316 16:33556031-33556053 CAGGGTTGACTGAGCTTTCAGGG + Intergenic
1138181781 16:54945380-54945402 GGGGCATGGCTGATCTTCCAGGG - Intergenic
1138423264 16:56913560-56913582 CTGGCTGGACTCCACTTCCATGG + Exonic
1203001443 16_KI270728v1_random:167776-167798 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
1203133046 16_KI270728v1_random:1704180-1704202 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
1203153481 16_KI270728v1_random:1856329-1856351 CAGGGTTGACTGAGCTTTCAGGG + Intergenic
1143951711 17:10637888-10637910 CTCACTTAACTGATCCTCCAGGG + Exonic
1144145336 17:12392443-12392465 CTGACTTGACTAATCTTAGAAGG - Intergenic
1146023204 17:29296445-29296467 CTGGGTCAACTGATCTGCCATGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147642940 17:42016105-42016127 CTGGCTTCTCTGATATCCCAGGG + Intronic
1151857800 17:76735802-76735824 CTGATTTGGCTGATCCTCCAGGG - Exonic
1155514121 18:26606733-26606755 CTGACTTGGCTGATCTTGAATGG - Intronic
1155549753 18:26952494-26952516 CTGGATGGACTGGTCCTCCAGGG - Intronic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1157104621 18:44762067-44762089 CTGGCCAGACTGGTCTTTCAAGG + Intronic
1157256912 18:46147790-46147812 CTGCCTTGATTGATATTCCATGG - Intergenic
1157476143 18:48024749-48024771 CTGGCATGATTCTTCTTCCATGG + Intergenic
1159932797 18:74331927-74331949 CTGGCTTAAGTGATTCTCCAGGG - Intronic
1163823121 19:19507608-19507630 CTGGCCTGGCTGTTCCTCCAGGG + Exonic
1168075525 19:53979076-53979098 CTGGCTTCACCTATCTTCCTAGG - Intronic
926538511 2:14144634-14144656 CTGGATTAATTGATCTTACATGG + Intergenic
926969159 2:18449705-18449727 ATGGCTTAACTAATTTTCCAAGG - Intergenic
927173907 2:20392140-20392162 CTGGCCTGACTCATCCCCCAGGG + Intergenic
927966305 2:27271636-27271658 CTGGCTTGTGTGTTCTTCCTAGG + Intronic
928257625 2:29737890-29737912 ATGGCCTGACTATTCTTCCAAGG - Intronic
928906848 2:36377235-36377257 CTGGGGTGACTAATCCTCCAAGG - Intronic
928948371 2:36792209-36792231 CTGCCTGGCCTGATTTTCCAGGG + Intronic
929036762 2:37700456-37700478 CTGGCCTTAAGGATCTTCCATGG + Intronic
929783309 2:44971749-44971771 CAGGCTTGAGTGATCCCCCATGG - Intergenic
931815483 2:65896568-65896590 TGGGCTTGGCTGATCTTACAAGG - Intergenic
934321189 2:91973692-91973714 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
935284910 2:101556083-101556105 CTGGCCTGACTGGTCTTACCGGG + Intergenic
936661263 2:114546612-114546634 ATGGCTTGACTGTTCTGTCAAGG - Intronic
938792759 2:134691311-134691333 GTGACTTGACTGCTCCTCCAGGG - Intronic
939972100 2:148674129-148674151 CTAGCTGGACTGATCTGCAAAGG - Intronic
940088685 2:149892434-149892456 CTCACTTGACTGAACATCCAAGG - Intergenic
941066133 2:160905008-160905030 CTGGCTTGAGGCATCTACCAGGG + Intergenic
941479767 2:165992012-165992034 CTCCCTTAACTGAGCTTCCAGGG + Exonic
942135943 2:172925646-172925668 CAGGCTCAACTGATCTTCCTGGG - Intronic
943769893 2:191705128-191705150 CTAGCTTGACTTCTCTTCCCAGG - Intergenic
1168776849 20:455145-455167 CTGGCTTGACTGCTGTTTCCTGG + Intronic
1172307108 20:33888736-33888758 CTGGCTGGACTGAGCTCCCTGGG + Intergenic
1172815025 20:37679472-37679494 CTGTCTTCACTGTGCTTCCAGGG - Intergenic
1173884706 20:46446882-46446904 CTGTCTTCACTGATATTGCAGGG + Intergenic
1173942169 20:46920798-46920820 CTGCCCTTACTGATTTTCCAGGG + Intronic
1176918619 21:14658306-14658328 CTGGCTTGGTTAAACTTCCATGG - Intronic
1178582385 21:33847719-33847741 ATGGCTTGAGTGACCTGCCATGG + Intronic
1178774628 21:35538006-35538028 CTGATTTGAATGATCTTCCAGGG + Intronic
1180309436 22:11157664-11157686 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
1180547913 22:16519475-16519497 CAGGGTTGACTGAGCTTTCAGGG - Intergenic
1182211547 22:28680896-28680918 CAGGGTTGACTGAGCTTTCAGGG + Intergenic
1183945980 22:41325964-41325986 CTGGCTCGACTGGGCATCCAGGG - Intronic
950849834 3:16051692-16051714 CTGGCTGGCCTGAGCTTCTATGG + Intergenic
952138305 3:30449177-30449199 CTGGCTTTTCTAATCATCCATGG + Intergenic
953643182 3:44728617-44728639 CTGACTTCACTGACCTTTCAGGG - Intergenic
962730287 3:138275715-138275737 CTTCCTGGACTGTTCTTCCAAGG - Intronic
963907750 3:150787020-150787042 TTGGGTTGACTGAGCTTCCAAGG - Intergenic
965114397 3:164469419-164469441 AAGGTTTGACTGATCTTTCATGG - Intergenic
965397746 3:168180550-168180572 CTAGCTTGACTGCCCTTTCAAGG + Intergenic
967883025 3:194314966-194314988 CTGGCTGGAAGGGTCTTCCATGG - Intergenic
970373797 4:15435853-15435875 CTGGCTTGCCTGGACCTCCAGGG + Exonic
971571046 4:28211059-28211081 CTGGCCTGATTTATCTTCTAGGG + Intergenic
973233489 4:47869753-47869775 CTGGATTGACTGTTCTTTTATGG - Intronic
977671188 4:99697639-99697661 CGAGCTTGACTGATCCTCTATGG - Intergenic
978460517 4:108946753-108946775 CTGGCTTGGGAGGTCTTCCATGG - Intronic
980139893 4:128902048-128902070 CTGGCTTGGCTAATCTTGCCTGG + Intronic
981270766 4:142845841-142845863 CTGGCCTCGCTGACCTTCCAAGG - Intronic
981547103 4:145904591-145904613 CTGGCTTCAGTGCTGTTCCATGG - Intronic
985344438 4:188988280-188988302 ATGGCTTGTCTGATCATGCAAGG - Intergenic
985638262 5:1050931-1050953 CTGGCTTGCATGGTCTCCCAAGG - Exonic
986040742 5:3991953-3991975 CTAGCTTGACTGCTCATTCATGG + Intergenic
987167247 5:15213473-15213495 CTGAATTAACTAATCTTCCATGG - Intergenic
992614276 5:78534380-78534402 CAGGCTGCACTGCTCTTCCAGGG + Intronic
995206584 5:109487786-109487808 CTGGCTTCACCTAGCTTCCAGGG + Intergenic
997174047 5:131755644-131755666 CTGTCTTTACTGATCTTCCCTGG - Intronic
997242205 5:132315655-132315677 CTGGCTTGACTGATCTTCCATGG - Intronic
999127251 5:149254750-149254772 CTGGCTTCACTGAGCTGCCCTGG - Intronic
999384761 5:151146195-151146217 CTGGCCTCTCTGATCTTCCAGGG + Intronic
999385552 5:151151564-151151586 CTGGCTTGCCTGAGGTTACATGG - Intronic
1003350047 6:5308189-5308211 CTGGCTTCATTGTTCTTCCCGGG - Intronic
1005091333 6:22060022-22060044 CTGACTTCACTGGTCTCCCACGG + Intergenic
1007298923 6:40851464-40851486 CTGGCTTGACTGCTCTAACTGGG - Intergenic
1007501357 6:42300200-42300222 CTGGCCTGACTGATCATCTAAGG + Intronic
1009997446 6:70912129-70912151 CTTGCTTGACTGCTCTGCCTAGG + Intronic
1010365137 6:75041655-75041677 CTGGCTGGGCTGATCTTCCCAGG + Intergenic
1013305625 6:108844498-108844520 GAGACTTGACTGATCTTCCTTGG + Intergenic
1014371466 6:120613887-120613909 CAGCCTCGACTGATCTTACATGG - Intergenic
1015525540 6:134172505-134172527 CTGGCTTGACTTAAGTGCCAAGG - Intronic
1022509825 7:30927979-30928001 CTGGCTGACCTGATCTTCCTAGG - Intergenic
1025115055 7:56250573-56250595 CTGGCTTGACTCATCCTCCTTGG + Intergenic
1031627548 7:124007977-124007999 CTGGTTTGTCTCATCTTCTAAGG - Intergenic
1033035444 7:137871826-137871848 CTGGACTGGCTGATCTTCCATGG - Intergenic
1037016140 8:13909236-13909258 TTGGCATCAGTGATCTTCCAAGG + Intergenic
1037317197 8:17610161-17610183 CTGTCCTCACTCATCTTCCAGGG + Intronic
1037649516 8:20823755-20823777 CTGGCTTGGCTGTTCTCCAAGGG + Intergenic
1040594690 8:48825716-48825738 CTGGCTGGGCTGAGCTTCCCAGG + Intergenic
1043364038 8:79510663-79510685 CTAGCTTGTCTGCCCTTCCAAGG + Intergenic
1045015444 8:97997450-97997472 CTGGGGTCACTGATCTTTCATGG + Intronic
1047364547 8:124200272-124200294 CTGGGCTGACTCATCTACCAGGG - Intergenic
1048455719 8:134576544-134576566 CTAGCTGGATTGATCTTACAAGG - Intronic
1048759253 8:137773642-137773664 CTGGCATGCCAGTTCTTCCAGGG - Intergenic
1049755389 8:144309215-144309237 CCGGCTTCACGGTTCTTCCATGG - Intronic
1053376899 9:37615060-37615082 CTTGCTTGTCTGACCTTGCAGGG + Intronic
1059736406 9:117104099-117104121 CTGGTTTGTCTGATCCCCCAGGG + Intronic
1060473414 9:123967502-123967524 CAGGCTTGGCTGATCTTTCCTGG + Intergenic
1062354472 9:136155077-136155099 CTTGCTTAACGGATCTTCCCAGG - Intergenic
1186070405 X:5813386-5813408 CTGGGTGAACTGATCATCCATGG - Intergenic
1186551412 X:10509641-10509663 CTAGCATTACTGATCCTCCAGGG + Intronic
1187225944 X:17375563-17375585 CTGGCTGGACTGATTTGCTAGGG + Exonic
1189848039 X:45154188-45154210 CTGGCTTGGCAGATCTTCCCTGG - Exonic
1192210973 X:69127504-69127526 GTTGCTTGACTGAGCTGCCATGG + Intergenic
1193835630 X:86340105-86340127 TTGGCTTGGCTGATTTTCCTAGG + Intronic
1196496222 X:116328005-116328027 CTGGCCTGACTGCTCATACAGGG - Intergenic
1199982300 X:152927794-152927816 CAGGCTTGTCTGCACTTCCAGGG + Intronic