ID: 997242638

View in Genome Browser
Species Human (GRCh38)
Location 5:132319041-132319063
Sequence ATGTAAATCCACTTCTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997242636_997242638 -9 Left 997242636 5:132319027-132319049 CCAAGGAAGGGAAAATGTAAATC 0: 1
1: 0
2: 0
3: 30
4: 295
Right 997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG No data
997242635_997242638 2 Left 997242635 5:132319016-132319038 CCAGTGACAAGCCAAGGAAGGGA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997242638 Original CRISPR ATGTAAATCCACTTCTGAAA GGG Intronic
No off target data available for this crispr