ID: 997247894

View in Genome Browser
Species Human (GRCh38)
Location 5:132366729-132366751
Sequence ACATCACATGGACCCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997247889_997247894 20 Left 997247889 5:132366686-132366708 CCTCAGTTCCTCATTAAATGTTG No data
Right 997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG No data
997247891_997247894 12 Left 997247891 5:132366694-132366716 CCTCATTAAATGTTGGCTAGAGA No data
Right 997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997247894 Original CRISPR ACATCACATGGACCCCTCAA AGG Intergenic
No off target data available for this crispr