ID: 997250063

View in Genome Browser
Species Human (GRCh38)
Location 5:132381820-132381842
Sequence AACCCTGAACTGCCAAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997250057_997250063 19 Left 997250057 5:132381778-132381800 CCATTTTGTTGACAGACTTTAAA 0: 1
1: 0
2: 0
3: 21
4: 409
Right 997250063 5:132381820-132381842 AACCCTGAACTGCCAAGGACTGG 0: 1
1: 0
2: 1
3: 8
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997250063 Original CRISPR AACCCTGAACTGCCAAGGAC TGG Intronic
900678475 1:3903144-3903166 AACTTTGAGCTCCCAAGGACTGG - Intergenic
901748841 1:11393431-11393453 AGCCCTGAACTGCCTAGATCTGG + Intergenic
908321774 1:62985555-62985577 AATCCTGAACTGAGAAAGACAGG - Intergenic
908780508 1:67685839-67685861 ACCCCTGCACGCCCAAGGACCGG - Intronic
910050426 1:82967192-82967214 AACCCTGCAGGGGCAAGGACTGG - Intergenic
911164637 1:94713832-94713854 ACCCCTGAACTGGGAAGGGCGGG - Intergenic
913741054 1:121845066-121845088 AAACCTGAACTGTCAGGGAAAGG + Intergenic
913750061 1:121953749-121953771 AAACCTGAACTGTCAGGGAAAGG + Intergenic
913988082 1:143584031-143584053 AACCATAAACTGCCAAGGTCAGG - Intergenic
916957030 1:169849194-169849216 AAACCTGAAATGCAAAGCACTGG + Intronic
917469521 1:175314517-175314539 AACCCTGAAGTGCCCAGGGGTGG - Intergenic
921557409 1:216615525-216615547 CACTCTGAAATGCCAAGAACTGG - Intronic
923143482 1:231181360-231181382 AATCCTGAAATGCAGAGGACGGG + Intronic
924154757 1:241164358-241164380 ACCCCTCAACTTCCAAGGAGGGG - Intronic
1064113918 10:12561463-12561485 GACTCTGAACTGCTAAGGAAGGG - Intronic
1064554064 10:16530676-16530698 AGCCCTGAACTGCCAACCACTGG + Intergenic
1070266104 10:74904674-74904696 AAGCCTGGACTCCCAAAGACTGG - Intronic
1070823078 10:79374637-79374659 AACCCTGACCTCCCCAGTACAGG - Intergenic
1073126778 10:101155741-101155763 GCCCCTGAAATGCCAAGGCCAGG - Intergenic
1074762381 10:116676646-116676668 AACCCTAAACTGCCAGGACCTGG + Intronic
1077657088 11:4029694-4029716 CACCCTGAGCTGCCGAGGATAGG + Intronic
1080680412 11:34470377-34470399 AACCCACAACTGGCAAGGTCAGG - Intronic
1083426166 11:62587603-62587625 AGCCCTGAACTGTCCAGGTCTGG + Intronic
1084483500 11:69435141-69435163 AACCCCCAAATCCCAAGGACCGG + Intergenic
1092334579 12:7618959-7618981 AACCTTGAACTGTGAAGGCCAGG + Intergenic
1095513558 12:42980287-42980309 AACCCTGAGTTGCCACAGACTGG - Intergenic
1095676312 12:44922926-44922948 AAACATGAACTTCCAAGAACTGG - Intergenic
1096603891 12:52751151-52751173 AAGCCTGAACTGCCAATGCTAGG + Intergenic
1098417127 12:70247045-70247067 AACCCTGAAGTGCCCAGAAAAGG - Intronic
1099627533 12:85093913-85093935 ACCCCTGAACTGAGAAGGAATGG + Intronic
1100353452 12:93806948-93806970 AACTCAGAACTACCCAGGACTGG + Intronic
1103599265 12:122043830-122043852 ATCCCACAGCTGCCAAGGACGGG - Intronic
1105899352 13:24742353-24742375 ATCCCAGACATGCCAAGGACAGG + Intergenic
1106006026 13:25770956-25770978 GCCCCAGAACTGCAAAGGACTGG - Intronic
1109039602 13:57315394-57315416 AACCCTGCAATGACAATGACAGG - Intergenic
1111411703 13:87885746-87885768 AATCCTGAAATGGCAAGGAAAGG - Intergenic
1112570799 13:100591182-100591204 AACCCTAAACTGACAAGCCCGGG - Intergenic
1114513428 14:23281092-23281114 ACTCCTGATCTGCTAAGGACAGG + Intronic
1114683789 14:24508434-24508456 AGCCCTGAACTCCCAAGTGCTGG + Exonic
1118730200 14:68660683-68660705 AACCAAGGACTGTCAAGGACTGG - Intronic
1120958763 14:90105699-90105721 AACTCTAAACAGACAAGGACAGG + Intronic
1121997952 14:98619810-98619832 AACCATGAACTGACCATGACAGG - Intergenic
1122685591 14:103504074-103504096 AACCCAGAACTGTCAAGACCTGG - Intergenic
1202902260 14_GL000194v1_random:50641-50663 CTCTGTGAACTGCCAAGGACAGG + Intergenic
1123478576 15:20610852-20610874 TACCCCAAACTGCCAAGGCCAGG - Intergenic
1123639437 15:22389533-22389555 TACCCCAAACTGCCAAGGCCAGG + Intergenic
1125102441 15:35930109-35930131 AACCCTGTGCTGCCAAGCTCTGG - Intergenic
1125416028 15:39453515-39453537 GACCCTGAACAGGCAAGAACAGG + Intergenic
1126055556 15:44726647-44726669 AACCCTGGATAGCCAAAGACAGG - Intergenic
1126720667 15:51575121-51575143 ATCACTGAACTGTCAAGTACTGG + Intronic
1128772974 15:70296381-70296403 CACCCTGAGTTGCCCAGGACAGG - Intergenic
1129386656 15:75200188-75200210 CACCCTGGACTGCCAAAGAAAGG - Intronic
1129752500 15:78076156-78076178 CCCCCAGAACTCCCAAGGACAGG + Intronic
1133287262 16:4696426-4696448 ACCCCTGAACAGCAGAGGACAGG + Intergenic
1134467811 16:14494840-14494862 AACCCTGCACTGCCCAGGCTAGG - Intronic
1135255953 16:20941767-20941789 CACCGTGCTCTGCCAAGGACAGG - Intronic
1138749496 16:59401885-59401907 AGCTCTAAATTGCCAAGGACAGG - Intergenic
1139198284 16:64947303-64947325 AACGCTGAACTGACAATGAAGGG - Exonic
1139382218 16:66539800-66539822 AACCCTGAACTCCCAGGTTCAGG - Intronic
1142064317 16:88052071-88052093 CACTCTTAACAGCCAAGGACAGG + Intronic
1145424552 17:22878677-22878699 AAACCTGAACTACCAAAGAAAGG - Intergenic
1145438258 17:23067826-23067848 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145445673 17:23170160-23170182 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145447603 17:23197112-23197134 AAACCTGAACTACCAAAGAAAGG - Intergenic
1145457833 17:23346780-23346802 AAACCTGAACTATCAAGGAACGG - Intergenic
1145458160 17:23351531-23351553 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145482101 17:23699144-23699166 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145491284 17:23832649-23832671 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145500813 17:23971771-23971793 AAACCTGAACTGTCAAAGAAAGG - Intergenic
1145531519 17:24418458-24418480 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145531719 17:24421343-24421365 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145593726 17:25322753-25322775 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145598496 17:25392663-25392685 AAACCTGAACTAACAAGGAAAGG - Intergenic
1145615825 17:25645322-25645344 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145623808 17:25761726-25761748 AAACCTGAACTGTCAAAGAAAGG - Intergenic
1145640056 17:25996971-25996993 AAACCTGAACTGTCAAAGAAAGG - Intergenic
1145648844 17:26125075-26125097 AAACCTGAACTGTCAAAGAAAGG - Intergenic
1145651163 17:26158492-26158514 AAACCTGAACTATCAAGGAAAGG - Intergenic
1145653602 17:26193620-26193642 AAACCTGAACTATCAAAGACAGG - Intergenic
1145656393 17:26234175-26234197 AAACCTGAACTATCAAGGAAAGG - Intergenic
1146418183 17:32656465-32656487 AAGCCTGAAGTGGCAGGGACTGG + Intronic
1153051352 18:905704-905726 GACCCTGAGCTGCCTAGGGCTGG - Intronic
1154162307 18:11989678-11989700 CACCCTGGAGTGCCAAGGGCTGG - Intronic
1155168577 18:23250311-23250333 CACCCTGAACTCCCAGAGACAGG - Intronic
1155740898 18:29286361-29286383 AGCCCTGACCTGCAAATGACAGG + Intergenic
1157153669 18:45244087-45244109 AATCCTGGACTGCCAAGTTCCGG + Intronic
1157213759 18:45764895-45764917 AACCCTTAACTGCAGAGGAAGGG + Intergenic
1159718675 18:71858378-71858400 AATCCTGAAGTGTCAAGGGCAGG - Intergenic
1160082254 18:75739469-75739491 AAACCTGAAATGCCAAGTGCTGG + Intergenic
1160772724 19:840346-840368 CACCCTGCAGTGCCCAGGACGGG - Intergenic
1161123904 19:2545260-2545282 CACCCTGCAGTGCCCAGGACAGG + Intronic
1161299726 19:3536950-3536972 AATCCTGCAGGGCCAAGGACTGG + Intronic
1161478925 19:4501113-4501135 AACCCTTGCCTGTCAAGGACTGG - Intronic
1162124743 19:8493437-8493459 GACCCTGGAGTGCCAAGGTCAGG - Intronic
1163699238 19:18778892-18778914 GACCCTGAGCTGCCAAGAAGGGG - Exonic
1165079427 19:33299072-33299094 ATCCCTGAACTAACAAGGCCCGG - Intergenic
1167814737 19:51869820-51869842 AAACCTCAACTGCCCAGCACAGG + Intronic
927312384 2:21645852-21645874 AACTCTGAACTCACAAAGACTGG + Intergenic
933480506 2:82851414-82851436 AACCCCGAACTGGGAAGGAATGG - Intergenic
935365375 2:102283897-102283919 AACACAGAACTGCCACGGAGAGG - Intergenic
935808304 2:106770627-106770649 TATACTGAACTGCCAAGGACAGG + Intergenic
935827129 2:106962934-106962956 ATCCCAGCACTGTCAAGGACTGG + Intergenic
939374507 2:141346406-141346428 AAACCTGCACTGCCCAGGAGAGG - Intronic
942028961 2:171939148-171939170 AACCCTGAACTGGGAAGGAATGG - Intronic
942668652 2:178349965-178349987 AACCCTAAGCTGCCATGGAGAGG - Intronic
943947871 2:194090643-194090665 AGCCCTTCACTGCCCAGGACCGG + Intergenic
944487741 2:200224515-200224537 AACCCTGAACTCCCAACCTCTGG + Intergenic
945041677 2:205747900-205747922 AACTCTGATCTTCCAAGGAATGG - Intronic
945791880 2:214315611-214315633 AACCTTGAACTGCCAGGCTCAGG + Intronic
945988673 2:216374874-216374896 AACAGAGAACTGCTAAGGACAGG + Intergenic
946234695 2:218316756-218316778 AAAACGGAACTGCCAAGCACTGG + Intronic
1176621628 21:9065408-9065430 CTCTGTGAACTGCCAAGGACAGG + Intergenic
1180676983 22:17593489-17593511 AACCCTGGACTTCCAAGGCTCGG + Intronic
1182137557 22:27919719-27919741 GAACCTGAGCTGCCAAGGGCTGG - Intronic
1184209586 22:43027655-43027677 AAGCCTGAAATGTCAAGGGCAGG + Intergenic
1185306679 22:50121493-50121515 AACCCAGCACTGCCCAGGCCGGG - Intronic
952234935 3:31469383-31469405 ATCCCTTCATTGCCAAGGACGGG - Intergenic
952609908 3:35195959-35195981 GACCCTGCACTGCCAAAAACAGG + Intergenic
953901653 3:46847046-46847068 ACCCCAGCACTCCCAAGGACCGG + Intergenic
954419901 3:50413221-50413243 AATCCTGAGCTGGCCAGGACTGG + Intronic
954424383 3:50435691-50435713 ACCCCTGGACTGCCAGGCACTGG - Intronic
955948265 3:64216357-64216379 ATCCCTGGACAGCAAAGGACTGG - Intronic
956230923 3:67015893-67015915 CAGCCTGAACTGACTAGGACAGG - Intergenic
957132883 3:76244522-76244544 AAGCCTGAACTGCCCAGGACTGG - Intronic
959357835 3:105354520-105354542 ATCCCTGGACTGGAAAGGACTGG - Intergenic
959925819 3:111920581-111920603 AACCAAGAACTGCCAGGTACTGG + Intronic
961790395 3:129371702-129371724 AAGCCTCAACTTCCCAGGACAGG - Intergenic
962958187 3:140285800-140285822 CACCCTGATTTGCCCAGGACTGG + Intronic
969214199 4:5709469-5709491 AACCCAGACCATCCAAGGACAGG + Intronic
971814476 4:31468503-31468525 CAACCTGAACTGACAAGGACAGG - Intergenic
973534621 4:51868182-51868204 ATCCCTGCACTCTCAAGGACTGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979623233 4:122819003-122819025 ACCCCTGAACTGGGAAGGAAAGG - Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
985753443 5:1697567-1697589 AACCCCGAACTGGGAAGGAATGG - Intergenic
987417670 5:17681162-17681184 ACCCCTGAACTGGGAAGGAAAGG + Intergenic
995861378 5:116644449-116644471 GACCCTGAACTGGGAAGGAATGG - Intergenic
996096046 5:119400341-119400363 AACCCTGGACTCCCAAGGCTGGG - Intergenic
996108841 5:119540330-119540352 AACTCTGCACTGCCATGCACCGG - Intronic
997250063 5:132381820-132381842 AACCCTGAACTGCCAAGGACTGG + Intronic
999133281 5:149300473-149300495 AACCCAGAGGGGCCAAGGACTGG - Intronic
1000338699 5:160260727-160260749 AGGCAAGAACTGCCAAGGACAGG - Intronic
1001265020 5:170268018-170268040 ACACCTGAAATTCCAAGGACAGG - Intronic
1002159892 5:177308884-177308906 AGCCCTGAAGTTCCAAGGACTGG + Intronic
1002918526 6:1548430-1548452 AACCCTCAAATGCCAAACACAGG + Intergenic
1004424951 6:15501018-15501040 TCCCCAGAACTGCCCAGGACCGG + Exonic
1006643413 6:35500029-35500051 CACCCTCAACTTCCAAGGCCGGG - Exonic
1007664416 6:43505906-43505928 GACCCTGAGCTGCCAAGGTGTGG - Exonic
1015604348 6:134939643-134939665 AATCATGAACTGCCAAGAAATGG - Intronic
1018664552 6:166123153-166123175 AACCCCGAACTGGGAAGGAATGG - Intergenic
1019698556 7:2461173-2461195 GCCCCTGGACTGCCAAGCACAGG - Intergenic
1019878609 7:3838599-3838621 AACCCTGAACTTCCAGAGGCTGG - Intronic
1023518035 7:41022162-41022184 AACAATGGACTGCCAAAGACAGG + Intergenic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1028607018 7:92666008-92666030 AACCCCCAACTGCCAAGGCATGG + Intronic
1030103075 7:105963064-105963086 AACTCTGAGCTGACCAGGACTGG + Intronic
1033969545 7:147023039-147023061 AACCCTGTACTGCAAAAGGCAGG - Intronic
1036376300 8:8203255-8203277 AATCCTTAATTTCCAAGGACAGG + Intergenic
1036653118 8:10658503-10658525 CTCCCTGCACTGCCAAGAACTGG - Intronic
1036684811 8:10902623-10902645 AACCCTGAAGAGCCAATGGCTGG - Intronic
1036853231 8:12219883-12219905 AATCCTTAATTTCCAAGGACAGG - Intergenic
1036874607 8:12462405-12462427 AATCCTTAATTTCCAAGGACAGG - Intergenic
1037988497 8:23304370-23304392 AAGCCTGCACTGCCCAGGCCCGG + Intronic
1039137497 8:34342034-34342056 AAGCCTGAACTGACAAAGACAGG + Intergenic
1041868492 8:62605329-62605351 AGCCCTGAGCTGCCCATGACCGG + Intronic
1044414815 8:91925734-91925756 AACCCTAAACAGACAGGGACGGG + Intergenic
1048222184 8:132552249-132552271 AACCATGAGCAGCCAAGGACAGG + Intergenic
1055812359 9:80163727-80163749 AACTCTGTCCTCCCAAGGACAGG + Intergenic
1057083384 9:92188950-92188972 CATCCGGACCTGCCAAGGACTGG + Intergenic
1057116222 9:92524930-92524952 TACCCTAAACTGCAAAGGAGAGG + Intronic
1057955037 9:99400602-99400624 AACTCTGCATTGCCAAGGAGAGG - Intergenic
1203744811 Un_GL000218v1:35818-35840 CTCCCTGAACTGCCGGGGACAGG + Intergenic
1203565293 Un_KI270744v1:83666-83688 CTCCCTGAACTGCCGGGGACAGG - Intergenic
1186797026 X:13056948-13056970 AAGCATGAAGTGCCCAGGACAGG - Intergenic
1188195069 X:27222916-27222938 AACCCACATCTGCCAAGGGCGGG - Intergenic
1189347032 X:40249529-40249551 AACCCTGACCTCCAAAGGAAAGG - Intergenic
1191257708 X:58286862-58286884 AACCCTGCAGGGCCCAGGACAGG - Intergenic
1191320345 X:59190476-59190498 GAACCTGAACTGTCAAAGACAGG - Intergenic
1191379567 X:59982325-59982347 GAACCTGAACTGTCAAAGACAGG - Intergenic
1191496659 X:61549855-61549877 GAACCTGAACTGTCAAAGACAGG - Intergenic
1192804774 X:74498952-74498974 AACCCTGAGCCCCAAAGGACTGG - Intronic
1193188853 X:78545465-78545487 AACCCTGCTCTGTCAAGGCCTGG + Intergenic
1197648467 X:129041463-129041485 GACCCTGAGCTGCCAAGGTGTGG + Intergenic
1198029467 X:132741128-132741150 AACCCTGAATTGCCCAAGCCTGG + Intronic
1201158150 Y:11150861-11150883 CTCTGTGAACTGCCAAGGACAGG + Intergenic