ID: 997251167

View in Genome Browser
Species Human (GRCh38)
Location 5:132389718-132389740
Sequence GTGGCTGACTGCCTCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997251167_997251168 -9 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251168 5:132389732-132389754 GTCAGCCACTGTGCCTACTGAGG 0: 1
1: 0
2: 0
3: 27
4: 297
997251167_997251176 30 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251176 5:132389771-132389793 CCGCTTCCAAGGAATGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
997251167_997251169 -8 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251169 5:132389733-132389755 TCAGCCACTGTGCCTACTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 236
997251167_997251172 19 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251172 5:132389760-132389782 CTATGAGTCACCCGCTTCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 63
997251167_997251173 24 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997251167 Original CRISPR GTGGCTGACTGCCTCAAAGC TGG (reversed) Intronic
905627979 1:39500984-39501006 GTGGCTGAAAGGCTCAAGGCTGG + Intronic
906896101 1:49774016-49774038 GTGGCTACTGGCCTCAAAGCAGG + Intronic
908641040 1:66223822-66223844 GTGGCTGACTACATCAAAGAAGG - Intronic
910066876 1:83164291-83164313 GGGGCTGACTGGCTGAAAACTGG - Intergenic
912948683 1:114105643-114105665 GTTGCTGAGAGCCTCACAGCTGG - Intronic
915513838 1:156401386-156401408 GTGGCTGCCTGCCGTAAAGTCGG + Intergenic
916034073 1:160905663-160905685 GTGGATCACTGCCTGAAAACAGG + Intergenic
916102662 1:161406255-161406277 GTGGATGCCTGTCACAAAGCTGG + Intergenic
917129227 1:171723554-171723576 AGGTCTGACTGCCTGAAAGCTGG - Intronic
920355294 1:205367636-205367658 ATGGCTGACAGCCTGGAAGCAGG + Intergenic
924835905 1:247647144-247647166 GTTGCTGATTGTCTCAAATCAGG + Intergenic
1065871131 10:29957406-29957428 GTGGCTGACTGCTTTAATGAAGG + Intergenic
1068987734 10:63122745-63122767 GTGGCTTCCTTCCTCAAAGCTGG + Intergenic
1069585858 10:69601497-69601519 ATGAATGACTGGCTCAAAGCAGG - Intergenic
1070034576 10:72709927-72709949 GTGGCCAACTGCCACAAAGTTGG + Intronic
1070805225 10:79266901-79266923 CTGGCTGATTTACTCAAAGCAGG - Intronic
1074236765 10:111592475-111592497 CTGCCTGACTGCCTTCAAGCTGG - Intergenic
1075515195 10:123102913-123102935 GGCGCTGCCTGCCTCACAGCAGG - Intergenic
1075520430 10:123140383-123140405 GTGGCCGCCTGCCTTTAAGCTGG + Intergenic
1076533901 10:131163610-131163632 GTGGCAGAGAGCCTCAAAGCTGG + Intronic
1079036130 11:17021770-17021792 CTGCCTGACTGCCTGCAAGCTGG - Intergenic
1081877724 11:46421371-46421393 CTGGCTTCCTGCCACAAAGCAGG - Intronic
1083819228 11:65157694-65157716 GTGGCAGACAGCCTCCAAGGTGG - Intergenic
1084368965 11:68725440-68725462 GGTGCAGACTGCCTCAATGCTGG + Intronic
1084453748 11:69255283-69255305 GTGGCTGAAATTCTCAAAGCTGG - Intergenic
1084651456 11:70491829-70491851 GTGGGTGCCTGGCTCAGAGCAGG - Intronic
1084906332 11:72350742-72350764 CTGACTGATTGCCTGAAAGCAGG - Intronic
1085736745 11:79045611-79045633 GTGGCTGCCTGCCTCCAAGCCGG - Intronic
1087303098 11:96458110-96458132 GTGGCTTAGTTCCTCAAAGCTGG - Intronic
1089734804 11:120543033-120543055 CTGGCTGAAAGCCTCATAGCTGG + Intronic
1091061931 11:132471723-132471745 GTGGTTGACAGCCTCCAAGATGG - Intronic
1094553363 12:31473239-31473261 GTGGCTTACAGCCTTAACGCAGG + Intronic
1100615084 12:96225198-96225220 CTGGCAGAGTGCCTAAAAGCTGG + Intronic
1101236180 12:102792591-102792613 GTTTCTTACTGCCTGAAAGCTGG - Intergenic
1102601583 12:114035433-114035455 GTGGCTGAGTGCCCCAAATCAGG - Intergenic
1103733786 12:123045631-123045653 TTGGCTGACAGCCTCAGTGCTGG - Intronic
1103836142 12:123822795-123822817 GTGCCTGACTGTCTTCAAGCTGG - Intronic
1103840556 12:123860306-123860328 GTGGCTTACTGACTCTAAGTGGG + Intronic
1104798565 12:131537096-131537118 GGGCCTGGCGGCCTCAAAGCTGG + Intergenic
1106248764 13:27968711-27968733 GTGGCTCACGGCCTCAACGGTGG - Exonic
1107767962 13:43757474-43757496 GTGGTTGGCTGACTGAAAGCTGG - Intronic
1111308412 13:86447465-86447487 CAGGCTAACTGCCTCAAGGCAGG + Intergenic
1113052039 13:106223353-106223375 TTGGCTGACAGCCTCTAAGCAGG + Intergenic
1113055221 13:106260248-106260270 GTAGCTAACTGCCACAAAACGGG - Intergenic
1113764838 13:112874736-112874758 GTGCCTGACACCCTCCAAGCTGG - Intronic
1120687721 14:87557552-87557574 CTGCCTGACTGCCTTCAAGCTGG - Intergenic
1122123363 14:99566420-99566442 AGGGCTGACTGGCTCACAGCCGG + Intronic
1122691983 14:103535835-103535857 GTGTCTGACAGCCTCAAGGAAGG + Exonic
1123124663 14:105937810-105937832 GTGGCTGAATGCCACAACCCTGG + Intergenic
1126068667 15:44846687-44846709 ATGCCTGACTGCTTCACAGCTGG + Intergenic
1126090159 15:45044110-45044132 ATGCCTGACTGCTTCACAGCTGG - Intronic
1128699983 15:69797102-69797124 GTGGCTCACTTCTTCCAAGCAGG + Intergenic
1132196706 15:99919093-99919115 CTGCCTGACTGCCTTCAAGCTGG - Intergenic
1132959682 16:2614841-2614863 ATGGCTCACAGCCTCAGAGCAGG - Intergenic
1132972742 16:2696816-2696838 ATGGCTCACAGCCTCAGAGCAGG - Intronic
1133605887 16:7387388-7387410 GTGACTGACGGCCTCAATTCTGG - Intronic
1140819382 16:78648805-78648827 GTGGCTGACTGCCTGGCTGCAGG + Intronic
1142174550 16:88639177-88639199 GTGGCTTGCTGCCTCCAGGCTGG - Exonic
1142919873 17:3175346-3175368 GTGGCTGACTGAAAAAAAGCAGG + Intergenic
1144462969 17:15472969-15472991 CTGGCTGACTGGCTTCAAGCTGG - Intronic
1155142663 18:23056868-23056890 GTGACTGACTGCCTGATAGAAGG + Intergenic
1156007394 18:32459430-32459452 GTGGCTGACTTCCTCTTAACTGG + Intronic
1158428242 18:57359041-57359063 GTGGCTGCCTGCCACAAAAGTGG + Intronic
1158891535 18:61876594-61876616 GTGGCTTACAGCATCAATGCTGG + Intronic
1164823875 19:31269904-31269926 GTGGCTGTCAGCCTCCATGCGGG - Intergenic
1165901522 19:39171572-39171594 GTGGCTGTCTGCCTGAAGCCGGG - Intronic
1168333883 19:55585968-55585990 GTCGCTGACTGGCTCAGGGCTGG + Intergenic
925489112 2:4372429-4372451 GTGGCAGGAAGCCTCAAAGCTGG + Intergenic
927971569 2:27308756-27308778 GTGGCAGACTGCCTCTCAGTGGG - Intergenic
928916795 2:36480818-36480840 GTGGGTGACTTCCACAAAACTGG - Intronic
929424393 2:41829292-41829314 GTGGCTGGCTGCCCCATGGCTGG - Intergenic
929879515 2:45823789-45823811 GTGGCTGCCAGCAGCAAAGCTGG - Intronic
932855684 2:75231922-75231944 GTGACTGACTGCTAAAAAGCAGG - Intergenic
932921362 2:75918289-75918311 GTGGCTGACTGCATTAAGCCAGG - Intergenic
933894673 2:86799797-86799819 GAGGCAGAGTGCCTCACAGCAGG + Intronic
935173531 2:100628855-100628877 GTGGCTGGCGGCCTCAGAGCTGG - Intergenic
937236105 2:120432722-120432744 GTGGCTGGCTGCATCCAAGGGGG + Intergenic
938376081 2:130807742-130807764 ATGGCTGACTGCACCAAGGCTGG + Intergenic
938683924 2:133718570-133718592 TTGGCTGGCTGCCCCAAAGTGGG - Intergenic
946052455 2:216875181-216875203 GTGGCTCTCTGCTTCAAAGAAGG - Intergenic
946161440 2:217838396-217838418 ATGGCTGACTGCCTCATGCCAGG - Intronic
947025032 2:225727893-225727915 CTGCCTGACTGCCTTAGAGCTGG + Intergenic
947497776 2:230650971-230650993 GTGATTGAGTGCTTCAAAGCAGG + Intergenic
947728943 2:232417685-232417707 GTGACTGTCTGACTCAGAGCTGG + Intergenic
948244166 2:236464204-236464226 GTGGCAGGCAGCCTCTAAGCTGG - Intronic
948499648 2:238382572-238382594 GTGGATGTCTGCCTCCAGGCAGG + Intronic
948573961 2:238937894-238937916 GTAGCTGAATGTTTCAAAGCTGG - Intergenic
1170647834 20:18212616-18212638 GTGGAGGTCTGCCTCAAAACTGG + Intergenic
1172701345 20:36855417-36855439 GTGCCTCACTACCGCAAAGCAGG + Intronic
1174281866 20:49445492-49445514 GTGGCTGGCTGCCCCAGACCTGG + Intronic
1175509529 20:59514594-59514616 GGGGCTGCCTGCCACACAGCAGG - Intergenic
1178029698 21:28510220-28510242 GTGGCTGACTGCCCCATGGAGGG + Intergenic
1181461605 22:23089142-23089164 GTGCCTGACTTCCTCAGAGACGG - Intronic
1181519568 22:23437297-23437319 GTTCCTGGCTGCCTCAAATCTGG + Intergenic
1184546893 22:45176550-45176572 TTGACTGACTCCCTCAAAACAGG - Intronic
950015576 3:9752714-9752736 GAGACAGACTGCCTCAAAACAGG + Intronic
950915770 3:16643854-16643876 CTGCCTGACTGCCTTCAAGCTGG + Intronic
954318286 3:49813141-49813163 GGTGCTGACTGCTGCAAAGCTGG - Exonic
954567560 3:51611446-51611468 GTGGTTCAATGCCTCAAAGTAGG + Intronic
954790650 3:53130700-53130722 GTGGCTGAAAGCCTCAGAGAAGG - Intergenic
956272557 3:67463319-67463341 GTTGCTGGCTGTCTTAAAGCAGG + Intronic
956429053 3:69166058-69166080 GTGACTGACTGCCACATAGTTGG + Intergenic
956705545 3:71995978-71996000 GCAGCTGCCTGCCTCAAAGATGG - Intergenic
960156132 3:114298643-114298665 GTGACTGAGTCCCTCAAGGCAGG + Intronic
960794797 3:121474025-121474047 GTTCCTGACTGCTTAAAAGCTGG - Intronic
961055890 3:123788621-123788643 GTGGCTGACTGCTTCTGAGCTGG + Intronic
962471779 3:135715395-135715417 GTGGAGGACTGCCTCCAAGAAGG - Intergenic
965932664 3:174065780-174065802 GTGGCTGTCTTCCTCACAGCAGG - Intronic
966766006 3:183463391-183463413 GTGTCTGACTTCCTCATAGATGG + Intergenic
967808612 3:193736632-193736654 GTGGCAGACTGCCACAGAGATGG + Intergenic
968128153 3:196175361-196175383 GGGGCTGCCTGCCACACAGCAGG - Intergenic
968737241 4:2303823-2303845 GTGGCTGCCTGGCTCACACCGGG - Intronic
969831481 4:9801168-9801190 GTGGTTGACTGCCTGTCAGCTGG - Intronic
972386475 4:38571356-38571378 GTGGCAGACAGCCTTCAAGCAGG + Intergenic
978325710 4:107551726-107551748 TTGCCTGACTGCCTTCAAGCTGG + Intergenic
980443864 4:132882738-132882760 GTGGCAGACTGCTTCCAAGGTGG - Intergenic
980907411 4:138961802-138961824 CTGGCTGGCTGCCTCAAGACTGG + Intergenic
985213320 4:187619314-187619336 GAGGCTGATTTCCTCAAAGGAGG - Intergenic
987146841 5:14999790-14999812 CTGACTGGCTGCCTCTAAGCAGG + Intergenic
988678369 5:33457995-33458017 ATTGCTGGCTGCCTCATAGCTGG - Intronic
990439453 5:55830088-55830110 GTAGCTGACTTCATCAGAGCAGG + Intergenic
993047477 5:82884338-82884360 AAGGCTGATTGACTCAAAGCAGG + Intergenic
995171048 5:109112504-109112526 GTGGGCCACTGCTTCAAAGCAGG + Intronic
996188097 5:120504488-120504510 GTGACAGACTACTTCAAAGCAGG - Intronic
997251167 5:132389718-132389740 GTGGCTGACTGCCTCAAAGCTGG - Intronic
1001951608 5:175820434-175820456 GTTCCTCACTGCCTGAAAGCAGG + Intronic
1002449067 5:179308836-179308858 GTGGCTGTCTGGCTCCCAGCTGG - Intronic
1002805348 6:568320-568342 CTGTCTGACTGCCTTCAAGCTGG + Intronic
1003572700 6:7266430-7266452 GTGGCTGACTTCCTCCAGGAAGG + Intergenic
1004205284 6:13586810-13586832 ATGGTTGACTCCCTCTAAGCAGG - Intronic
1004490218 6:16108008-16108030 CTGCCTGACTGCCTCCAAGTTGG + Intergenic
1006457271 6:34139048-34139070 CTGGCTGACTGCCTGGGAGCAGG - Intronic
1007806495 6:44453766-44453788 GTTGCTGACTGCCTGAAACGTGG + Intergenic
1010472856 6:76250575-76250597 GTGGATAACAGCCTCCAAGCTGG + Intergenic
1011282344 6:85689547-85689569 GTGGCTATCTGCCTCAAGGATGG + Intergenic
1011514496 6:88137923-88137945 GTGGCTGTCTGGGTCAAAACTGG + Intergenic
1019591693 7:1838981-1839003 GTTCCTGGCTGCCTCAAATCTGG - Intronic
1027277232 7:76570473-76570495 GGGGCTGACTGGCTGAAAACTGG + Intergenic
1028809609 7:95069223-95069245 GTGTATGACTGCCTTAAAGGAGG + Intronic
1032017518 7:128389355-128389377 GGAGCTGAGTGCCTCACAGCTGG + Intergenic
1037823829 8:22148752-22148774 GTGGCTGACAGCTCCAAGGCAGG - Exonic
1038227531 8:25670663-25670685 GTGGCTGCCTGCCTCACCTCAGG + Intergenic
1039554495 8:38466921-38466943 GTGTCTGGCTGCCTCATAGGGGG + Intronic
1041381982 8:57260542-57260564 ATGGCGGACAGCCGCAAAGCTGG + Intergenic
1042375945 8:68052345-68052367 GTAGCTGTCTGCCTAACAGCGGG - Intronic
1042753276 8:72181769-72181791 CTGCCTGACTGCCTCCAAGCTGG + Intergenic
1045189174 8:99866278-99866300 GAGGCTGCCTCTCTCAAAGCAGG + Intronic
1045744481 8:105401509-105401531 GTCTCAGAGTGCCTCAAAGCAGG - Intronic
1049253930 8:141604060-141604082 GGGCCTGGCTCCCTCAAAGCTGG + Intergenic
1049560326 8:143307030-143307052 GTGGCTGTCTCCCTCACACCGGG - Intronic
1050353763 9:4763908-4763930 GTGGCAGACTGCCTCTCTGCCGG - Intergenic
1051515899 9:17930206-17930228 GTGGATGACTCCATCAAACCAGG - Intergenic
1057193397 9:93099868-93099890 GTGGCTGATGGCCTCAATGTGGG + Intronic
1057751309 9:97795635-97795657 CTGCCTGACTGCCTCCAAACTGG - Intergenic
1058635016 9:107030013-107030035 GGAGCTCACTGCCTCAAAGAAGG - Intergenic
1059181976 9:112224635-112224657 GTGGCTGTCAGCCTCTAAGGTGG + Intronic
1059442156 9:114314443-114314465 CTGCCTGACTGCCTTCAAGCTGG - Intergenic
1062524561 9:136973007-136973029 GTGGCTGCCTCCCTCCCAGCTGG + Intergenic
1186174225 X:6908057-6908079 GTGGCTGTTTGCCCCAAAGCTGG - Intergenic
1193902680 X:87202277-87202299 CTGCCTGACTGCCTTTAAGCTGG + Intergenic
1199386504 X:147229422-147229444 CTGCCTGACTGCCTCCAAACTGG + Intergenic