ID: 997251170

View in Genome Browser
Species Human (GRCh38)
Location 5:132389737-132389759
Sequence CACTCCCTCAGTAGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997251170_997251176 11 Left 997251170 5:132389737-132389759 CCACTGTGCCTACTGAGGGAGTG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 997251176 5:132389771-132389793 CCGCTTCCAAGGAATGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
997251170_997251173 5 Left 997251170 5:132389737-132389759 CCACTGTGCCTACTGAGGGAGTG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87
997251170_997251178 22 Left 997251170 5:132389737-132389759 CCACTGTGCCTACTGAGGGAGTG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 997251178 5:132389782-132389804 GAATGGCCCAGGATCCCTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 139
997251170_997251172 0 Left 997251170 5:132389737-132389759 CCACTGTGCCTACTGAGGGAGTG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 997251172 5:132389760-132389782 CTATGAGTCACCCGCTTCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997251170 Original CRISPR CACTCCCTCAGTAGGCACAG TGG (reversed) Intronic
900887846 1:5428030-5428052 CACATCCTGAGCAGGCACAGTGG - Intergenic
901153674 1:7121677-7121699 CCCTACCTCAGCAGGCACAGTGG - Intronic
901678076 1:10898401-10898423 CCCTCCCACAGCAGGCACAGCGG + Intergenic
902729865 1:18362310-18362332 CACTCCCTTTCCAGGCACAGTGG - Intronic
903677080 1:25071200-25071222 CACTCACACAGGAGGCCCAGGGG - Intergenic
905906733 1:41623505-41623527 CACAACCTCAGAAAGCACAGGGG + Intronic
906739889 1:48172675-48172697 CTCCCCATCAGGAGGCACAGGGG + Intergenic
908720432 1:67119885-67119907 CACTCCCACAACAGGCCCAGAGG + Intronic
911084389 1:93964509-93964531 CACTACCTCAGTTAGCTCAGTGG + Intergenic
912235408 1:107844991-107845013 CTCCCACTCAGGAGGCACAGGGG - Intronic
912370593 1:109171258-109171280 CCCTCCCTGACTAGGCGCAGTGG + Intronic
912429661 1:109622394-109622416 GACTGCCTCAGTAGGCACAGGGG - Intronic
915104855 1:153527445-153527467 AAGTCCCTCAGCAGACACAGTGG + Intergenic
916709403 1:167390121-167390143 TTGTCCCTCAGTATGCACAGGGG - Intronic
917153368 1:171968011-171968033 CAAACCTTCAGTGGGCACAGAGG + Intronic
917953671 1:180069034-180069056 AACTCCCTCAGGAGGCTGAGTGG - Intronic
922176768 1:223203125-223203147 CTCTCCCTCAGCAGAGACAGCGG - Intergenic
922423164 1:225472676-225472698 CACTCCCTCAGTTTGCAGGGAGG + Intergenic
922545229 1:226451805-226451827 CACTCCCTCACTGGGCCAAGTGG - Intergenic
922691983 1:227700314-227700336 CTCCCCATCAGGAGGCACAGGGG - Intergenic
1063498623 10:6533083-6533105 CTCTGCATCTGTAGGCACAGGGG - Intronic
1063519903 10:6731729-6731751 CACTCTCTCAGCATGCAGAGAGG - Intergenic
1063982912 10:11470299-11470321 CACAGCCTCTGTAGGGACAGAGG + Intronic
1064791033 10:18958249-18958271 CACTCTCTCAGTGGACGCAGTGG + Intergenic
1065952172 10:30662329-30662351 CACTTACACAGTATGCACAGCGG + Intergenic
1066233995 10:33468003-33468025 CACTCCCTCAGCTTGCAGAGAGG + Intergenic
1067410036 10:46056038-46056060 GACTCCCTCATTAGCCAAAGAGG - Intergenic
1069062339 10:63907033-63907055 CACTCCCTCTGAAGGCACTAGGG - Intergenic
1069751034 10:70745136-70745158 CACTCCCTCACTGGGCACCCAGG - Intronic
1072668223 10:97410012-97410034 CTTTCTCTCAATAGGCACAGGGG - Intronic
1073303306 10:102484126-102484148 CACTCCATCCCTAGGCCCAGGGG + Intronic
1075510624 10:123069900-123069922 CACTGTCTCAACAGGCACAGAGG - Intergenic
1075654126 10:124150309-124150331 CAGTCCCACAGTAGGTACTGAGG + Intergenic
1075679252 10:124320824-124320846 CCTTCACTCAGCAGGCACAGAGG - Intergenic
1076389869 10:130091105-130091127 CTCTCAGTCAGGAGGCACAGGGG - Intergenic
1081198865 11:40193139-40193161 CTCCCCATCAGGAGGCACAGGGG - Intronic
1082998763 11:59273132-59273154 CCCTCCCTCAGTGGGAAAAGGGG - Intergenic
1084954025 11:72681931-72681953 CATACCCTAAGTAGGCACAGTGG + Intergenic
1086421982 11:86645736-86645758 CTCTCCTTCAGGAGGCACAGGGG - Intronic
1088843250 11:113644223-113644245 CTCTCCCTCAGTGGGCATTGAGG + Intergenic
1089519891 11:119056719-119056741 CACTGCGTCTGTGGGCACAGCGG - Intronic
1090254733 11:125275511-125275533 TACTCCCTCAGCAGCCAGAGTGG - Intronic
1093097302 12:14985853-14985875 CCCTACCTGAATAGGCACAGTGG + Intergenic
1095438595 12:42219238-42219260 CTGTCCCTCAGGAGGCCCAGTGG - Intronic
1097464572 12:59906496-59906518 CACAAACTCAGTAGGCAAAGAGG + Intergenic
1100401156 12:94231335-94231357 GAAACCCTAAGTAGGCACAGAGG + Intronic
1100464603 12:94834152-94834174 CAGTCCCCCAGCAGGCACAGGGG + Intergenic
1101986201 12:109449361-109449383 CACTAGCTCATTAGGCATAGAGG + Exonic
1101998467 12:109541736-109541758 CACTCCCTCTGGAGGCTCTGGGG + Intergenic
1104005046 12:124885913-124885935 CACTCCCTCTGAAGGCTCCGAGG + Intergenic
1106373622 13:29162080-29162102 CACTGCCTCTGTATTCACAGAGG + Intronic
1109140999 13:58714053-58714075 CACTCCCTCAGCTGGCAGGGAGG + Intergenic
1109661556 13:65467055-65467077 CACCCAGTCAGGAGGCACAGGGG + Intergenic
1111577560 13:90176150-90176172 CTCTCCCTCAGAAGACAGAGGGG - Intergenic
1112364561 13:98745668-98745690 CACTCCCTCCGAAGGCTCTGGGG - Intronic
1113016709 13:105835995-105836017 CACTGCGGCAGCAGGCACAGAGG + Intergenic
1114053490 14:18943881-18943903 CATGCCCTCAGTAGGAACATGGG - Intergenic
1114109069 14:19458044-19458066 CATGCCCTCAGTAGGAACATGGG + Intergenic
1117286603 14:54291558-54291580 CCCTCCACCAGCAGGCACAGGGG + Intergenic
1118208554 14:63745948-63745970 CAGTCTCTCAGAAGGCTCAGAGG + Intergenic
1120281124 14:82439194-82439216 AACTCCCTCTCTAGACACAGGGG - Intergenic
1120456597 14:84738785-84738807 CACTCATTAAGTGGGCACAGTGG - Intergenic
1121051021 14:90819000-90819022 CACTGCCTCAGTTGCCACACTGG + Intergenic
1122699127 14:103575466-103575488 CACTCCCACTGCAGGCACCGTGG - Intronic
1124349550 15:28944968-28944990 CACTGCCTCCCTAGGCAAAGCGG - Intronic
1124689716 15:31811896-31811918 CACTCGCTCACTCTGCACAGCGG + Intronic
1126489931 15:49225681-49225703 CACACCCTCAGAAGACAGAGAGG - Intronic
1126642347 15:50840814-50840836 CACTCCCACCATAGGAACAGAGG - Intergenic
1127479682 15:59367251-59367273 CATGCCCACACTAGGCACAGAGG + Intronic
1128264401 15:66254172-66254194 CACTCCCCCAGGAGGGAAAGGGG - Intergenic
1128520200 15:68370093-68370115 CACTCCCTCCGCAGGCTCTGGGG - Intronic
1128853981 15:70991346-70991368 CTGTCCCTCAGTATCCACAGGGG + Intronic
1131874035 15:96785782-96785804 CTCTGCCCCAGTAGGCACACTGG - Intergenic
1132339401 15:101068583-101068605 GCCTTCCTCAGAAGGCACAGGGG + Intronic
1133266849 16:4590133-4590155 TACTCCCTCGGGTGGCACAGTGG + Intronic
1135325343 16:21521979-21522001 CCTTCCCTCTGCAGGCACAGCGG - Intergenic
1135509831 16:23072858-23072880 CACTCACTCAGTTAACACAGCGG - Intronic
1136336829 16:29615247-29615269 CCTTCCCTCTGCAGGCACAGCGG - Intergenic
1138131879 16:54486724-54486746 CAAACCCTGAGTAGGCACTGGGG + Intergenic
1139045663 16:63056180-63056202 TCCTCCCTCTGTAGGCACTGTGG + Intergenic
1140165309 16:72544187-72544209 CTCTCAGTCAGGAGGCACAGGGG - Intergenic
1140715771 16:77724105-77724127 CACTCCCTTAGAAGGCTCTGGGG + Intronic
1141246053 16:82308866-82308888 CTCTCAGTCAGGAGGCACAGGGG + Intergenic
1141268670 16:82519790-82519812 CACTCCCTCGGGAGGCTCTGGGG - Intergenic
1142037555 16:87871030-87871052 CCTTCCCTCTGCAGGCACAGCGG - Intergenic
1142262561 16:89049744-89049766 CACTGTCTCGGGAGGCACAGTGG + Intergenic
1143651664 17:8267224-8267246 CACTCCCTCACCAGGCTCACGGG - Exonic
1144689094 17:17247998-17248020 CATGCCCTCAGGAGACACAGAGG + Intronic
1147057278 17:37844317-37844339 GACTTCCTCATTAGGCACATGGG + Intergenic
1147260791 17:39208908-39208930 CACCCCCAGAGTGGGCACAGAGG + Intergenic
1147316465 17:39623278-39623300 GACACCCTCAGTAGGAGCAGTGG - Intergenic
1147763213 17:42814665-42814687 GCCTTCCTCTGTAGGCACAGTGG - Exonic
1148290053 17:46438038-46438060 GGCTCCCTCAGTAGTCACAGAGG - Intergenic
1148312221 17:46655610-46655632 GGCTCCCTCAGTAGTCACAGAGG - Intronic
1149592406 17:57840864-57840886 TTGTCCCTCAGTATGCACAGGGG - Intronic
1150556580 17:66260121-66260143 CAATCCCACAGTAGCCACAATGG - Intergenic
1150852274 17:68714979-68715001 CCCTACCACAGTAGTCACAGGGG - Intergenic
1150884679 17:69071277-69071299 CTCTCTGTCAGAAGGCACAGGGG - Intergenic
1152433946 17:80263894-80263916 CAGAGCCTCAGTAGCCACAGAGG - Intronic
1157084381 18:44564022-44564044 TGCTCCCTCTGTAGGCACCGGGG - Intergenic
1157984683 18:52423570-52423592 CATTCTGTCAGTAGGCAGAGAGG + Intronic
1160522203 18:79514151-79514173 CACACCCTCAGCCAGCACAGTGG + Intronic
1160755839 19:756879-756901 TCCTCCCTCAGTAAGCCCAGAGG + Exonic
925918552 2:8624189-8624211 CACTCCCTCCCTGGGCACGGAGG + Intergenic
926153228 2:10435953-10435975 CTATGCCTCACTAGGCACAGGGG - Intergenic
927682533 2:25149513-25149535 AGCTCCCTGAGCAGGCACAGAGG - Intronic
929419903 2:41779857-41779879 AACTGCTTCAGTGGGCACAGAGG - Intergenic
930854456 2:55997750-55997772 CATTTCCTCAGTAGACACTGGGG + Intergenic
931636437 2:64344556-64344578 AAATCCCTCAGCAGGAACAGTGG - Intergenic
932486427 2:72086860-72086882 CACTCCCTCAGTTTGCAGGGAGG + Intergenic
933330960 2:80892598-80892620 TACTCCCTCATTAGGCATTGTGG + Intergenic
934714302 2:96534729-96534751 GACCCCCTCTGTAGGCACAGAGG + Intergenic
936451134 2:112634853-112634875 GCCTGCCTCAGCAGGCACAGAGG - Intergenic
936738398 2:115474870-115474892 CACTCCCATAATAGGCTCAGAGG + Intronic
937486793 2:122323795-122323817 CTCACCCTCAGGAGGCACTGTGG + Intergenic
938458939 2:131485231-131485253 CACTCCCTCAGTCAGGACAAAGG - Intronic
938696204 2:133837590-133837612 CACACCCTGAGGTGGCACAGGGG + Intergenic
940122805 2:150286425-150286447 CACTCCCTCTGAAGGCTCCGGGG + Intergenic
940839109 2:158558921-158558943 CATTCACTCAGGAGGCACCGTGG - Intronic
940865936 2:158817892-158817914 CTCTTCCTCAGGAGGGACAGTGG - Intronic
940946575 2:159624378-159624400 CTCCCCATCAGGAGGCACAGGGG - Intergenic
941076457 2:161010990-161011012 CTCCCCATCAGGAGGCACAGGGG - Intergenic
942139883 2:172967330-172967352 CTCCTCCTCAGTAGGCAAAGGGG - Exonic
942199970 2:173560602-173560624 CTCCCCATCAGGAGGCACAGGGG - Intergenic
943105808 2:183544273-183544295 CTCCCCATCAGGAGGCACAGGGG - Intergenic
947500123 2:230665464-230665486 CACTCACTCAGCAAGCACTGAGG - Intergenic
1169666147 20:8038496-8038518 CACTCACACAGAAGGCACAAGGG - Intergenic
1170454670 20:16520715-16520737 CTCTCAGTCAGGAGGCACAGGGG - Intronic
1174673723 20:52332978-52333000 CGCTCCCTCAGGAGGCTCTGGGG + Intergenic
1176037076 20:63044771-63044793 CACTCCCTGAGGCGGCACAGTGG - Intergenic
1178380576 21:32104233-32104255 CACTCCCTCAGGAGGCTCTAAGG - Intergenic
1180471959 22:15666262-15666284 CATGCCCTCAGTAGGAACATGGG - Intergenic
1180972240 22:19821716-19821738 CCATCCCTGAGTGGGCACAGCGG + Intronic
1183598958 22:38828974-38828996 CACGCCCTGAGTGGGCCCAGTGG - Intronic
1184863318 22:47189148-47189170 TCCTCCCTCAGGAGGGACAGAGG + Intergenic
1185040957 22:48504171-48504193 CACTCCCTCGGCTGGCAGAGTGG + Intronic
950366847 3:12492041-12492063 TAATCCCTCAGTATCCACAGGGG - Intronic
953293926 3:41694284-41694306 CCGTCCCTCAGTATCCACAGGGG + Intronic
954330095 3:49885210-49885232 CAGTGCCTCAGCAGGCACTGAGG - Intergenic
954433045 3:50481454-50481476 CACTCCCTCACGAAGCGCAGCGG - Intronic
960703381 3:120458981-120459003 CACTCCCTCAGTAGAGTCTGGGG - Intergenic
961145510 3:124589731-124589753 TTGTCCCTCAGTAGCCACAGGGG + Intronic
961509039 3:127390095-127390117 CACCCCATCAGCAGGCACAGGGG + Intergenic
961737443 3:129010866-129010888 CAGGCCCTCAGGATGCACAGGGG + Intronic
962156926 3:132957397-132957419 CTCCCCATCAGGAGGCACAGGGG - Intergenic
963421095 3:145061636-145061658 CCCTCCCTTAATAGGCCCAGAGG - Intergenic
963711039 3:148747590-148747612 CTCTCCCTGAGATGGCACAGGGG + Intergenic
967122102 3:186391366-186391388 AACTCCATCACCAGGCACAGTGG - Intergenic
967143804 3:186588457-186588479 CCCTCACTCAGTTGGCCCAGTGG + Intronic
967842907 3:194021209-194021231 TACTCCCTCAGAAGGCTCAAGGG - Intergenic
968472284 4:787660-787682 CACTCCCTCTGGAGGCTCTGGGG - Intronic
968608110 4:1545213-1545235 GACTCCCTCAGTAGGGCCTGCGG - Intergenic
969179143 4:5424003-5424025 CACTCCCCCCGTAGGCTCAGGGG + Intronic
969491694 4:7502851-7502873 CTCTCCCTCAGTCGCCACAGCGG - Intronic
969946803 4:10791480-10791502 CACCCCCTCAGAATGCAGAGAGG - Intergenic
971371657 4:26024189-26024211 CCCTGCCTCAGCAGGCACGGTGG - Intergenic
977632915 4:99263269-99263291 CTCTCAGTCAGGAGGCACAGGGG + Intergenic
978090354 4:104707538-104707560 CTCCCTCTCAGGAGGCACAGGGG - Intergenic
979303368 4:119113206-119113228 TACTCTCTCAGTGGGGACAGTGG + Intergenic
979761809 4:124415233-124415255 CACTCCATCAAAAGGCACAAAGG - Intergenic
980211225 4:129790994-129791016 TTCACCCCCAGTAGGCACAGAGG + Intergenic
981778514 4:148397948-148397970 CACTCCCTCTGAAGGCTCTGGGG + Intronic
982749440 4:159142011-159142033 CACACACTCAGAAGGTACAGGGG - Intronic
982909158 4:161117701-161117723 CTCCCCATCAGGAGGCACAGGGG + Intergenic
986484411 5:8220696-8220718 CTCCCCATCAGGAGGCACAGGGG - Intergenic
986745000 5:10736157-10736179 CACTCCCTCTGCAGGCGCTGGGG - Intronic
990528094 5:56648242-56648264 CACTCGCGCATTAGGGACAGGGG - Intergenic
995252206 5:110006450-110006472 CTCCCCTTCAGGAGGCACAGGGG + Intergenic
995815782 5:116166528-116166550 CACCCCATCAGGAGGCACGGGGG - Intronic
995857383 5:116607695-116607717 CCCACCCTCAGTGGGAACAGGGG + Intergenic
996815249 5:127566873-127566895 TAATCCCTCAGTGGGCAAAGAGG + Intergenic
997251170 5:132389737-132389759 CACTCCCTCAGTAGGCACAGTGG - Intronic
997653243 5:135537191-135537213 CACTCACCCAGGAGCCACAGGGG + Intergenic
998303116 5:141045607-141045629 CACTCCCCCTGAAGGCATAGAGG + Intergenic
998923872 5:147101052-147101074 CACTCCCTTAGGTGGAACAGGGG - Intergenic
999030001 5:148280737-148280759 CTCCCCCTCAGGAGGCACGGGGG + Intronic
999468726 5:151831833-151831855 CTCTCCATCAGGAGGCACAGGGG - Intronic
999491212 5:152053232-152053254 CCTTCCCTCAGTAACCACAGGGG - Intergenic
1002335453 5:178474927-178474949 CACTCCCTCTGAAGGCTTAGGGG + Intronic
1002485337 5:179531602-179531624 CAGTCCCTCTGTATCCACAGGGG + Intergenic
1002801385 6:524909-524931 CACTCCTGCAGAAGGCACAGAGG - Intronic
1003520577 6:6855352-6855374 CACTCCCTCAGTAGAGGCACAGG - Intergenic
1005795829 6:29360466-29360488 CTCTCAGTCAGTAGGCACTGGGG - Intronic
1006302643 6:33201731-33201753 CTCTCCCTCACCAGGCACTGGGG + Exonic
1009458821 6:63888324-63888346 CTCCCCTTCAGGAGGCACAGGGG - Intronic
1010126687 6:72440651-72440673 CACTCTGTCAGAAAGCACAGAGG - Intergenic
1012083009 6:94784893-94784915 CTCCCTCTCAGGAGGCACAGGGG + Intergenic
1014223477 6:118822572-118822594 CTCTCAGTCAGGAGGCACAGGGG + Intronic
1015998284 6:139016831-139016853 CACTCTCTCAGGATGAACAGAGG - Intergenic
1019128613 6:169858066-169858088 CACTCTGGCAGGAGGCACAGCGG - Intergenic
1019217381 6:170452479-170452501 GACCCCCTCAGTAGGCACCTGGG + Intergenic
1020484615 7:8705916-8705938 CAGTTACTCAGTAGACACAGTGG - Intronic
1021166936 7:17353901-17353923 CTCCCCCTCAGGAGGCACAGGGG + Intergenic
1021930690 7:25578360-25578382 CACTTCCTCAGGAGGCCCAGGGG + Intergenic
1022368946 7:29752342-29752364 CACTCCCTGACAAGACACAGAGG - Intergenic
1023802980 7:43850963-43850985 CACTGCCTTCGTAGGCCCAGCGG + Intergenic
1024964126 7:55006522-55006544 CACCCCCTCATTAGGCTCACGGG - Intergenic
1025962661 7:66237256-66237278 TACTCATTCAGTAGGTACAGAGG - Intronic
1026415754 7:70178917-70178939 CACTTCCTCATGAGTCACAGTGG - Intronic
1027434740 7:78152816-78152838 GGCTCACTCAGGAGGCACAGTGG - Intronic
1028144372 7:87305043-87305065 CTCCCAGTCAGTAGGCACAGGGG - Intergenic
1029441146 7:100587218-100587240 CGCTCCCTCAGTTTTCACAGTGG + Intronic
1031173267 7:118317774-118317796 CTCCCCATCAGGAGGCACAGGGG + Intergenic
1031292544 7:119955185-119955207 CAAACCTTCAGTAGGCAGAGAGG + Intergenic
1032786619 7:135205819-135205841 TTCTCCTTCAGCAGGCACAGAGG + Intronic
1033477462 7:141704533-141704555 CACTCTCTCAGCAGGCAGGGAGG + Intergenic
1034260980 7:149755304-149755326 CACTCCCTCTGAAGGCTCAAGGG - Intergenic
1034534764 7:151719854-151719876 AACTACCTCAGTAGGCACAGGGG - Intronic
1035243087 7:157544795-157544817 CACACCCTCAGCAGACACAAGGG - Intronic
1038169508 8:25116194-25116216 CACTCCCTCCGAAGGCTCCGAGG - Intergenic
1039133915 8:34298257-34298279 CTCCCCGTCAGGAGGCACAGGGG - Intergenic
1039844552 8:41316632-41316654 CGCTCTCTCAGTGGGCTCAGTGG - Intergenic
1041257195 8:55989462-55989484 CTCTCCCTCATGAGGCACTGCGG - Intronic
1047252506 8:123191540-123191562 CACTCCCACAATGGGCATAGGGG + Intronic
1048575020 8:135683453-135683475 CACACCCTTAGCAGGCACAAAGG - Intergenic
1051489602 9:17646828-17646850 CTCCCCATCAGGAGGCACAGGGG + Intronic
1051571423 9:18563466-18563488 CTCTCAGTCAGGAGGCACAGGGG + Intronic
1052541071 9:29811768-29811790 CACCCACTAAGGAGGCACAGTGG + Intergenic
1055338913 9:75261416-75261438 CTCCCACTCAGGAGGCACAGGGG + Intergenic
1057397118 9:94690084-94690106 CACCCCCTCTGAAGGCTCAGGGG - Intergenic
1062315430 9:135964848-135964870 CGCTCCCTCTGGAGCCACAGGGG + Intergenic
1062495045 9:136827656-136827678 CCCTCCCTCACAAGGTACAGGGG - Intronic
1186192866 X:7083082-7083104 CACTCCCTCTGTAGGCTCTAGGG - Intronic
1188292503 X:28406498-28406520 CCCTCCCTCAGAAGGAATAGAGG + Intergenic
1188296426 X:28455870-28455892 CTCCCCATCAGTAGGCACAGGGG - Intergenic
1188938546 X:36208331-36208353 TCATCCCTCAGTATGCACAGGGG + Intergenic
1189358147 X:40327167-40327189 TCCTCCCTCAGTTGACACAGAGG + Intergenic
1190566188 X:51732476-51732498 CACTCCATCACAAGGCCCAGAGG + Intergenic
1192221315 X:69199062-69199084 CACTCCTTCAGTGGGCAGGGGGG + Intergenic
1192915987 X:75651914-75651936 CTCTCAGTCAGGAGGCACAGGGG + Intergenic
1193265454 X:79463551-79463573 CAATCCCCCAGTACCCACAGGGG + Intergenic
1193683834 X:84553509-84553531 CACTCCCTCAGTGTCCAGAGAGG + Intergenic
1196582646 X:117394651-117394673 CACTCCCTCAGCTTGCAGAGAGG + Intergenic
1196781515 X:119387975-119387997 CACTCCCTCAGCTTGCAGAGAGG - Intergenic
1199448510 X:147954110-147954132 CAATCTCTCAGGTGGCACAGAGG - Intergenic