ID: 997251171

View in Genome Browser
Species Human (GRCh38)
Location 5:132389745-132389767
Sequence ACTCATAGCACTCCCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997251171_997251173 -3 Left 997251171 5:132389745-132389767 CCTACTGAGGGAGTGCTATGAGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87
997251171_997251172 -8 Left 997251171 5:132389745-132389767 CCTACTGAGGGAGTGCTATGAGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 997251172 5:132389760-132389782 CTATGAGTCACCCGCTTCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 63
997251171_997251176 3 Left 997251171 5:132389745-132389767 CCTACTGAGGGAGTGCTATGAGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 997251176 5:132389771-132389793 CCGCTTCCAAGGAATGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
997251171_997251178 14 Left 997251171 5:132389745-132389767 CCTACTGAGGGAGTGCTATGAGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 997251178 5:132389782-132389804 GAATGGCCCAGGATCCCTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997251171 Original CRISPR ACTCATAGCACTCCCTCAGT AGG (reversed) Intronic
905205351 1:36340193-36340215 ACTCATGCCTCTGCCTCAGTGGG - Exonic
905480309 1:38257385-38257407 ACACATAGCTGGCCCTCAGTCGG - Intergenic
908254158 1:62288857-62288879 GCTCATACCACTTCCTCATTTGG - Intronic
909198511 1:72658349-72658371 ACACATAGAATTTCCTCAGTGGG - Intergenic
910089819 1:83449271-83449293 CCTCTTAGCACTCCCTCAACAGG + Intergenic
913168041 1:116207314-116207336 AGTCATAGCACTCACTCTGTTGG - Intergenic
913645755 1:120852314-120852336 AATCCCAGCACTCCCTCAGGAGG + Intergenic
914080886 1:144410563-144410585 AATCCCAGCACTCCCTCAGGAGG - Intergenic
914175800 1:145279094-145279116 AATCCCAGCACTCCCTCAGGAGG - Intergenic
914530519 1:148520579-148520601 AATCCCAGCACTCCCTCAGGAGG - Intergenic
917496964 1:175549157-175549179 ACCCAAAGCAGACCCTCAGTGGG - Intronic
919777504 1:201203791-201203813 ACTCATAGCGCTTCCCCAGCCGG - Exonic
1073824359 10:107303535-107303557 CCTTATAGCAATGCCTCAGTGGG + Intergenic
1075374444 10:121967012-121967034 ACTCATAAGATACCCTCAGTAGG + Intronic
1083160455 11:60851090-60851112 ACTCATAGCACTTCCCCCATTGG - Exonic
1087709124 11:101529774-101529796 ACTGATAGAAGTGCCTCAGTGGG + Intronic
1090578199 11:128131945-128131967 AATCATAACAAACCCTCAGTGGG + Intergenic
1091948550 12:4571472-4571494 ACTCACAGCACACCCCCAGTAGG - Intronic
1101085107 12:101227659-101227681 CCACCTAGCCCTCCCTCAGTGGG + Intergenic
1102503776 12:113371269-113371291 ACTCAAAGCAGTCCCAAAGTGGG + Intronic
1105882793 13:24618311-24618333 ACTCATATCACTCCTGCAGAGGG + Intergenic
1109967822 13:69724316-69724338 ACTCATAACACACCCTCAGGAGG - Intronic
1120422316 14:84303316-84303338 ACACCTAGCTCGCCCTCAGTGGG + Intergenic
1122293691 14:100693376-100693398 ACACATAGCTCTCCCTGAGAGGG + Intergenic
1128862258 15:71083732-71083754 ACTCAGATCATTACCTCAGTAGG - Intergenic
1131242490 15:90758854-90758876 ACCCTTCCCACTCCCTCAGTAGG - Intronic
1136524721 16:30821635-30821657 GCTCTCAGCACTCCCTCTGTGGG - Intergenic
1139711690 16:68781164-68781186 ACTCAAAGCACTCACACAGGAGG + Intronic
1144307032 17:13978156-13978178 ACACATCTCACCCCCTCAGTGGG + Intergenic
1147844501 17:43395238-43395260 ACTCAGAGGGCTCCCTGAGTAGG - Intergenic
1153179600 18:2418108-2418130 ACTAATAGCACAGCCTCAGTTGG + Intergenic
1153400084 18:4675253-4675275 AATCATAGCAACTCCTCAGTTGG - Intergenic
1153580050 18:6563543-6563565 ACTCATAGCACTGACTTAGAGGG + Intronic
1155027860 18:21958501-21958523 ACTCACAGCAGACCCGCAGTGGG + Intergenic
1158886730 18:61835299-61835321 ACACATACCACTCCATCAGGTGG - Intronic
1161216431 19:3097094-3097116 ACTCATTCCACTCTCCCAGTAGG + Intronic
1167970056 19:53183688-53183710 TCTGATATCACTTCCTCAGTGGG - Intronic
927249971 2:20988745-20988767 AATCATTGCACTACCTCAGAGGG - Intergenic
929549152 2:42878473-42878495 ACTCAGAGCATCCCCTCACTGGG + Intergenic
935639171 2:105274502-105274524 CATCATAGCAGCCCCTCAGTGGG - Intronic
935888190 2:107647885-107647907 AGTCATCTCAGTCCCTCAGTGGG - Intergenic
939681562 2:145141404-145141426 ACACATTGTAGTCCCTCAGTAGG - Intergenic
943801922 2:192071034-192071056 ATTCAAAGCATTCGCTCAGTAGG - Intronic
944190972 2:197003438-197003460 ACACATAGCATTCCTTAAGTGGG + Intronic
946054325 2:216887655-216887677 ACTCAAGGTACTGCCTCAGTGGG + Intergenic
947317725 2:228879647-228879669 CCTCATAGAATTCCTTCAGTGGG + Intronic
947764774 2:232630576-232630598 TCTAAAAGCACTCCCTCATTTGG + Intronic
947866396 2:233400634-233400656 ACACATTTGACTCCCTCAGTGGG + Intronic
1169966319 20:11221702-11221724 CCTCATAAGACACCCTCAGTAGG + Intergenic
1173148442 20:40545474-40545496 CCACATAGCACATCCTCAGTTGG - Intergenic
1181746154 22:24956229-24956251 ACTGATACCACTCCCTCTGAGGG - Intronic
951064657 3:18249800-18249822 TCTCTGAGCAGTCCCTCAGTAGG + Intronic
952983397 3:38756465-38756487 CCTGAGAGCACTCCCTCAATAGG + Intronic
953675702 3:45000280-45000302 CCTCATAGCACCCCTTCTGTTGG + Intronic
955447487 3:59029578-59029600 TCTCATAGCACTCACTCTGCTGG - Intronic
961461012 3:127050420-127050442 CCGCATAGTGCTCCCTCAGTGGG - Intergenic
963771492 3:149390961-149390983 ACTCATAGCACGCTGTCAGCAGG - Intergenic
968867058 4:3219910-3219932 TCTCCCAGCACTCCCTGAGTGGG + Intronic
979176631 4:117672448-117672470 GCTTATAGCACTCACTCTGTGGG + Intergenic
980525706 4:133988975-133988997 ACTCATACCACTGCTTCAGAGGG - Intergenic
983668866 4:170213300-170213322 ACTCAGAGCAGTTCCTTAGTAGG + Intergenic
990020062 5:51115364-51115386 ACACATAGCCCTGCCTCATTTGG - Intergenic
997251171 5:132389745-132389767 ACTCATAGCACTCCCTCAGTAGG - Intronic
998872334 5:146565069-146565091 ACTCAGTGCTCTCCCTGAGTGGG - Intergenic
1002077652 5:176718430-176718452 ACTCCTAACATTCCCCCAGTAGG + Intergenic
1015614889 6:135064380-135064402 ACTCATAACACAGCCTCAGGAGG - Intronic
1021820896 7:24496610-24496632 GATCTTAGCACTCCCTGAGTAGG + Intergenic
1023561744 7:41481236-41481258 ACTCATTGCACTCTATCAGGTGG - Intergenic
1027306675 7:76905718-76905740 CCTCTTAGCACTCCCTCAACAGG + Intergenic
1034762036 7:153681628-153681650 ACTCAAAGCTCTCCCTCCCTGGG + Intergenic
1034815794 7:154170908-154170930 CTTCTTAGCACTCCCTCGGTGGG + Intronic
1041032614 8:53753536-53753558 TCTCACAGCACTGCCTCAGCTGG - Intronic
1042129133 8:65569626-65569648 TCTCATTGCACTCCCTGGGTTGG - Intergenic
1044249535 8:89989726-89989748 ACACATACCACCCTCTCAGTTGG + Intronic
1045616865 8:103924970-103924992 ACTGACAGCACTCCCTTATTAGG + Intronic
1052477623 9:28980688-28980710 ACTCAGAGGACTCCCTGAGCAGG - Intergenic
1053380958 9:37649842-37649864 ACTCCTGCCACTCCCTCTGTGGG + Intronic
1056819344 9:89826438-89826460 ACGCACAGCACTCCTTCACTTGG + Intergenic
1062149501 9:135010306-135010328 GCTCTTAGCACTCCACCAGTGGG - Intergenic
1187318399 X:18219612-18219634 ACTCAAAGCTCTCACCCAGTGGG + Intronic
1190497192 X:51037985-51038007 TCTCCTACCACTCCCTCAGAAGG + Intergenic
1190508792 X:51156278-51156300 TCTCCTACCACTCCCTCAGAAGG - Intergenic
1193179679 X:78440066-78440088 ACTCATAACACAGCCTCAGGAGG - Intergenic
1194596657 X:95867650-95867672 ACTCTTAACAGTCTCTCAGTTGG + Intergenic
1196462715 X:115946552-115946574 CCTGAAAGCACTCTCTCAGTTGG - Intergenic
1196468344 X:115995245-115995267 TCTGATAGCTCTCCCTCTGTAGG - Intergenic
1199621507 X:149705671-149705693 CCTCACATCAGTCCCTCAGTGGG + Intronic