ID: 997251173

View in Genome Browser
Species Human (GRCh38)
Location 5:132389765-132389787
Sequence AGTCACCCGCTTCCAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997251167_997251173 24 Left 997251167 5:132389718-132389740 CCAGCTTTGAGGCAGTCAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87
997251171_997251173 -3 Left 997251171 5:132389745-132389767 CCTACTGAGGGAGTGCTATGAGT 0: 1
1: 0
2: 0
3: 4
4: 82
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87
997251170_997251173 5 Left 997251170 5:132389737-132389759 CCACTGTGCCTACTGAGGGAGTG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997251173 Original CRISPR AGTCACCCGCTTCCAAGGAA TGG Intronic
900372242 1:2337169-2337191 AGGCACTCGCTTCCAGGGTAGGG + Intronic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
905678456 1:39847547-39847569 AGTAACCAGCTTCTAAAGAAAGG - Exonic
910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG + Exonic
912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG + Intronic
913877614 1:124080549-124080571 AGAAACCCGTTTCCAAGGAAAGG - Intergenic
915656910 1:157368309-157368331 AGGCACCTGATTCTAAGGAAAGG - Intergenic
920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG + Intergenic
920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG + Intergenic
922607648 1:226900517-226900539 GGTCACCCGCTGAGAAGGAAGGG + Intronic
924718645 1:246602619-246602641 AGTAACCTGCTTCTAATGAAAGG - Intronic
1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG + Intergenic
1068738932 10:60447143-60447165 AGTCACCCCCTTCCCTGAAATGG - Intronic
1070027132 10:72642431-72642453 AGTCACCCGCTTCCAATGTGTGG - Intergenic
1075183464 10:120233204-120233226 ACTCACCAGCATCCAAGGATGGG - Intergenic
1083462937 11:62826734-62826756 AGGCACCCGCTACCAATGACTGG - Intronic
1084473573 11:69376652-69376674 TGGCACCCCCTTCCCAGGAAGGG - Intergenic
1087616174 11:100488931-100488953 TGTCACCCCTTTCCTAGGAAAGG - Intergenic
1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG + Intronic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1108909213 13:55521818-55521840 AGTCAACGGCTTCAAAGGACAGG - Intergenic
1113564994 13:111314420-111314442 AGCCACACGCGTCCATGGAAGGG + Intergenic
1113565008 13:111314469-111314491 AGCCACACGCATCCATGGAAGGG + Intergenic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1124516478 15:30370929-30370951 AGTCACCCGGGCCCAAGTAAGGG - Intronic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1131792637 15:95981624-95981646 AGTCACCCGCCACTAAGGGACGG - Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1137315219 16:47312329-47312351 AGTCACCTGCTTAGAAGGAAAGG - Intronic
1138577171 16:57915410-57915432 AGTCTCTCCCTTCCATGGAAAGG + Intronic
1140196740 16:72861415-72861437 AGTAACCCGCCTCCCAGGGAGGG - Intronic
1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG + Intronic
1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG + Intronic
1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG + Intergenic
1144369875 17:14579893-14579915 AATCACTCTCTACCAAGGAAGGG - Intergenic
1155518825 18:26649161-26649183 AGTCACGTGCTGCCAGGGAATGG - Intronic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1168691702 19:58381259-58381281 AGTCACCCGCTTTCACGAGAAGG - Intergenic
930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG + Intergenic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
941444387 2:165582565-165582587 GGTCACCCACTTCCTAGGACAGG - Intronic
946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG + Exonic
948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG + Intergenic
1169603455 20:7289099-7289121 AGTCACCATCTTCCAAGCATTGG + Intergenic
1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG + Intronic
1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG + Intergenic
1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG + Intronic
953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG + Intronic
954432062 3:50476066-50476088 AGGGACCCTCTTCCAAGGGAAGG - Intronic
955103463 3:55874170-55874192 AGTCAACTGCCTCCAAGGTATGG - Intronic
960543876 3:118889872-118889894 AGTCACTCCCTTCCAGGAAAAGG - Intergenic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG + Intronic
970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG + Intergenic
976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG + Intronic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
984548279 4:181132255-181132277 ATACACCCGTTTCCAAGGAGGGG + Intergenic
986561660 5:9066377-9066399 ACTGACCCACTTCCATGGAAGGG - Intronic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1000779268 5:165460014-165460036 AGTCTCCCGTTTCCAAATAAAGG + Intergenic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1002433134 5:179215603-179215625 AGTCACAAGCCTCCAAGGATAGG + Intronic
1003667101 6:8121578-8121600 ACTCACTCACCTCCAAGGAAGGG - Intergenic
1007843225 6:44733679-44733701 AGTCACCCACTGCCAAGTTAGGG - Intergenic
1011752926 6:90471613-90471635 AGTCACGTGCTTCCAAGCCAAGG - Intergenic
1014734295 6:125074066-125074088 AGTCACCCACTGGAAAGGAATGG + Intronic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1016845641 6:148565627-148565649 ACTCACCCACTTCTAAGGGATGG + Intergenic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG + Intergenic
1022796628 7:33736674-33736696 AGTCACCCGCTTCACAAGTAAGG - Intergenic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG + Intergenic
1035655380 8:1301281-1301303 AGACAGCAGCTTCCATGGAAGGG - Intergenic
1039124484 8:34185839-34185861 AGACATCTGGTTCCAAGGAAAGG + Intergenic
1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG + Intergenic
1045108271 8:98915036-98915058 AGACACCCACCTCAAAGGAAAGG + Intronic
1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG + Intronic
1052414111 9:28156314-28156336 AGTAACCCCATTCTAAGGAATGG + Intronic
1053516692 9:38736227-38736249 AGTCACCCCCTTCCAAGGCCTGG - Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1055795947 9:79975187-79975209 GGTCAGACGCTTCAAAGGAAGGG - Intergenic
1056163421 9:83920767-83920789 AGTCACCTGCCTCCGAGGGAGGG + Intronic
1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG + Intergenic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1186776872 X:12873641-12873663 AGTCCCCCTCTTCCCAGGGAAGG + Intronic
1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG + Intronic
1193772889 X:85608636-85608658 AGTGACCCACGTCCAGGGAAAGG + Intergenic
1197723042 X:129757978-129758000 AGTCACACGTTTGGAAGGAATGG - Intronic
1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG + Intergenic