ID: 997257973

View in Genome Browser
Species Human (GRCh38)
Location 5:132443812-132443834
Sequence CAGTAAGTACAGCTTATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997257973_997257974 8 Left 997257973 5:132443812-132443834 CCTTCAATAAGCTGTACTTACTG 0: 1
1: 0
2: 0
3: 18
4: 119
Right 997257974 5:132443843-132443865 CTCTCTGTAAAGTAATCTGCTGG No data
997257973_997257975 27 Left 997257973 5:132443812-132443834 CCTTCAATAAGCTGTACTTACTG 0: 1
1: 0
2: 0
3: 18
4: 119
Right 997257975 5:132443862-132443884 CTGGTTGTAGTAGAGACACAAGG 0: 1
1: 0
2: 0
3: 7
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997257973 Original CRISPR CAGTAAGTACAGCTTATTGA AGG (reversed) Intronic
903234842 1:21943296-21943318 CAATAAGCACAGCTTAGTGACGG + Intergenic
904071626 1:27803519-27803541 CTGTCAGCACATCTTATTGAAGG + Intronic
910369553 1:86502008-86502030 AAGTCAGTACTGTTTATTGAGGG + Intergenic
913482565 1:119303022-119303044 CAGCAATTACTGCATATTGAAGG - Intergenic
913545996 1:119869859-119869881 AGATAAGTACAGCTTATTGAAGG + Intergenic
914455780 1:147835036-147835058 CACTAAGTAGAGCTTATTTGGGG - Intergenic
915330378 1:155108100-155108122 CAGGAAGGACAGCTTGGTGATGG - Intergenic
916686256 1:167150039-167150061 CAATAAGGATGGCTTATTGAAGG + Intergenic
919337649 1:196259326-196259348 CAGTAAGTATTGCTTATTAAAGG - Intronic
920263425 1:204705141-204705163 AAGAAAGTACAGCCTATTTAAGG - Intergenic
921805837 1:219453985-219454007 CATTAAGTAGAGCATGTTGAGGG - Intergenic
923010404 1:230083658-230083680 CAGCAAGGACAGCTTTCTGAAGG - Intronic
923781226 1:237026363-237026385 CAGTAAGTATAGCTGAATGAAGG + Intergenic
924131884 1:240918238-240918260 CATTAAATTCAGCTGATTGATGG - Intronic
1064865827 10:19878621-19878643 GGGTAAGGATAGCTTATTGATGG - Intronic
1069825846 10:71254551-71254573 CATTCAGGCCAGCTTATTGATGG - Intronic
1077786508 11:5390012-5390034 CAGTCCATACAGATTATTGAAGG - Exonic
1080851369 11:36073066-36073088 TAGTAAGTAGAGCTCATTGCTGG + Intronic
1084631717 11:70356383-70356405 CAGAAAGTACGGCTTAATTAAGG - Intronic
1086516220 11:87616487-87616509 CTCTAAGTACAGTTCATTGAAGG - Intergenic
1087149530 11:94846179-94846201 CAGGAAGGACAGCTAATTCAGGG - Intronic
1088278109 11:108110482-108110504 CAGTAATTACAGCATAATAAAGG - Intergenic
1099789827 12:87319127-87319149 CAGAAAATACTGCTTAGTGAAGG - Intergenic
1101488084 12:105185560-105185582 CAGTGGGTACAGCCTATGGAGGG - Intronic
1101798989 12:108003999-108004021 CTGTAGCTCCAGCTTATTGACGG + Intergenic
1106906205 13:34412189-34412211 CAGCATGTACAGAATATTGAAGG + Intergenic
1107055709 13:36101142-36101164 CAGTTTGTGCAGCGTATTGAGGG + Intronic
1107143949 13:37036776-37036798 CAGTAAGTATATCATATTAAAGG - Intronic
1110019868 13:70457132-70457154 CAGTGAGTACAGCCCATGGAGGG + Intergenic
1118619847 14:67604619-67604641 CAGTAAGCCCAGCTTACTGTAGG + Intergenic
1118732784 14:68680764-68680786 CAGAAATCACAGTTTATTGAAGG - Intronic
1120024097 14:79563025-79563047 CAGTAAGTTGAGCTTATTGGGGG - Intronic
1121066467 14:90971495-90971517 CAGTAAATACAGCATATTGTAGG + Intronic
1124356318 15:28997510-28997532 CAGTAAGGACAGCTTATGAAGGG + Intronic
1125261385 15:37829593-37829615 AAGTAAGTAAAGTTTATTCAAGG + Intergenic
1126592831 15:50356714-50356736 CAGTAAGTACAGATGTTTGGAGG + Intergenic
1134913763 16:18051950-18051972 CAGCAAGTACAGCCCATGGAAGG + Intergenic
1141489058 16:84359598-84359620 CAGTAAGCAGACCTTGTTGAGGG + Intergenic
1142295661 16:89220212-89220234 TAGTAAGTACAGTTTATACAAGG + Intronic
1149080632 17:52652225-52652247 CAGTAGGTACAGTTTAAGGAGGG + Intergenic
1149718478 17:58818557-58818579 CACTAAGTAAAGCTTATATATGG - Intronic
1151089909 17:71426396-71426418 CAGCAAGTCCAGATTATTGATGG + Intergenic
1158985401 18:62810463-62810485 CCCTAAGTACAGTATATTGAGGG - Intronic
1159238032 18:65702929-65702951 GAGTAAGAACAGCTTTTGGATGG - Intergenic
1165582128 19:36875463-36875485 TAGTAGCTACAGCTTATTGTTGG + Intronic
1167282015 19:48574933-48574955 AAGTAACTGCAGTTTATTGAAGG + Intronic
1202634498 1_KI270706v1_random:32334-32356 CAGTGAGAACTGCTTATTGCAGG + Intergenic
925392800 2:3509311-3509333 CAATAAGAACAGTTGATTGATGG - Intronic
926608072 2:14917565-14917587 CAGGAAGCAGAGATTATTGAGGG + Intergenic
926819540 2:16837569-16837591 CAGTGAGTAGAGGTGATTGATGG + Intergenic
928561461 2:32491299-32491321 TAGTAATTACAGTTTATTAAAGG - Intronic
934896034 2:98121077-98121099 TAGTCAGCACAGCTTATAGAAGG + Intronic
940910632 2:159206539-159206561 CAGCAAGAACAGCTTGATGAAGG - Intronic
943621938 2:190158538-190158560 ATGTAAGTACAGCTTGTTTATGG - Intronic
1170360737 20:15543386-15543408 CAATAACTAGAGTTTATTGAGGG - Intronic
1175412316 20:58778403-58778425 CAGTAGGTACAGCATCTTGTGGG + Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177232953 21:18346587-18346609 CTGAATGTACAGCTAATTGACGG - Intronic
1177721557 21:24913863-24913885 CAATAAGTGCAGCTTAGTGTGGG - Intergenic
1177903964 21:26952530-26952552 CAATAAGTGCAGCTTCTTCAGGG - Intronic
1182146470 22:27999727-27999749 CAGTATGTAGAGCTTCTTAAAGG - Intronic
1184614391 22:45628161-45628183 CAGTAATTACAGTTTATGGCAGG + Intergenic
949113533 3:292533-292555 CAGTAGGTAAATCTTATTGGGGG + Intronic
951762987 3:26165002-26165024 CAGCAAGTACCGCTTTTTGGGGG - Intergenic
953270495 3:41438304-41438326 CACTTAGTACATCTTATTCATGG + Intronic
954998127 3:54900699-54900721 CCTAAAGTACAACTTATTGAGGG - Intronic
955550434 3:60079141-60079163 CAGTAAGTATAGCTTGTTTTTGG + Intronic
957042827 3:75349914-75349936 CAGTAAGTACTGAGTATTGTGGG - Intergenic
957621698 3:82602303-82602325 CAGGAGGTACTGTTTATTGAAGG + Intergenic
957882397 3:86236645-86236667 CAGTAAGAACAGCTTACAGTGGG - Intergenic
958097125 3:88960640-88960662 AATTAAGTCCAGTTTATTGATGG - Intergenic
958643169 3:96835304-96835326 AAGTATGTACAGCTTATCAAAGG + Intronic
961924338 3:130461367-130461389 CAGAAGCTACTGCTTATTGAGGG + Intronic
963636571 3:147804910-147804932 CAAGAAATACAGCTTATTGGAGG - Intergenic
963738962 3:149055743-149055765 CAGGAAGTAGAGATCATTGAGGG - Intronic
965766925 3:172140634-172140656 CAGAAAGTCCAGGTTATGGAAGG + Intronic
972898217 4:43650375-43650397 CAGTAACTACTGTATATTGAAGG + Intergenic
973928623 4:55765897-55765919 CAGGCAGTAGAGCTCATTGAGGG - Intergenic
975366627 4:73536842-73536864 CACTAAGTACATTTTATAGATGG + Intergenic
979169553 4:117583608-117583630 AAGTAAGTACAACTTAGTGTTGG - Intergenic
979539350 4:121863196-121863218 CAGTAAGTATAGCTTTGTGAAGG - Exonic
980828305 4:138098461-138098483 CAGGAAGGACAGCTTGCTGATGG + Intergenic
984759976 4:183355611-183355633 CAATAAGGTCAGCTCATTGAGGG - Intergenic
985172923 4:187171677-187171699 CAGGAAACACAGCTAATTGAGGG - Intergenic
988289719 5:29270168-29270190 CAGTGAGTCCAGCTCATGGAGGG + Intergenic
989393661 5:40929389-40929411 CAGTAAGTTCAGATTGTTCAAGG + Intronic
991041162 5:62177036-62177058 CAGTAAGTACTGTTTGTTGATGG - Intergenic
991190911 5:63872309-63872331 GAGTAAGAACAGCTTAATGAAGG + Intergenic
992570498 5:78050633-78050655 CACAAAGAACAGCTTATTGAGGG + Intronic
995781203 5:115777206-115777228 CAGGAAGTAAAGATCATTGATGG + Intergenic
996931132 5:128889661-128889683 CAGGAAGTAGAGATGATTGATGG - Intronic
997257973 5:132443812-132443834 CAGTAAGTACAGCTTATTGAAGG - Intronic
1002717397 5:181236112-181236134 AAGCAACTACAGCATATTGAAGG - Intergenic
1005216605 6:23535926-23535948 AAGTGAGTGGAGCTTATTGAAGG - Intergenic
1009290006 6:61869685-61869707 CAGTGGGTACAGCTCATGGAGGG + Intronic
1011351163 6:86425487-86425509 GAGTAAGAACATCTTGTTGAGGG + Intergenic
1012058276 6:94444039-94444061 CACAAAGAACAGCATATTGATGG + Intergenic
1012940960 6:105415135-105415157 CAGTAGGTACAGCCCATGGAGGG + Intergenic
1013376556 6:109521455-109521477 GAGTAAGGACATCTTCTTGATGG - Intronic
1014263275 6:119245537-119245559 CTGGAAGTACAGCTGATTCAAGG + Intronic
1020482963 7:8684835-8684857 CAGCAAGTACATCTTATAGAAGG - Intronic
1020693955 7:11392222-11392244 CAGTAAGTGCAGCCCATGGAGGG + Intronic
1023302958 7:38793131-38793153 AAGTAAGTATAGCATGTTGAAGG - Intronic
1028613836 7:92741876-92741898 TAGTAAGTACAAGTTATTCAGGG + Intronic
1028663379 7:93310792-93310814 AATTAAGTACAGAATATTGATGG - Intronic
1028883187 7:95903198-95903220 TAGTAAGTACCGTATATTGAAGG + Intronic
1030031469 7:105373760-105373782 CAGTAAGGTCAGCTTACTGCAGG - Intronic
1030954608 7:115836924-115836946 GATTCAATACAGCTTATTGAAGG - Intergenic
1031454266 7:121959923-121959945 CACTAAGTAGAGTTTATTCAAGG + Intronic
1031741673 7:125440205-125440227 CAGTAAGTAAAGCTGATAGTGGG - Intergenic
1036948227 8:13115585-13115607 CAGTATGCACAGCTTTATGAAGG - Exonic
1040873942 8:52130444-52130466 AAATAAGTAGTGCTTATTGATGG - Intronic
1042871740 8:73405808-73405830 CAGAAAGGAAAGCTTACTGATGG - Intergenic
1043346280 8:79301921-79301943 CACTCAGTAGAACTTATTGAAGG + Intergenic
1044462704 8:92464565-92464587 CAGTAAATATTGTTTATTGAAGG + Intergenic
1049269690 8:141687803-141687825 CAATAAATACAGCTGAATGAAGG - Intergenic
1052286176 9:26788514-26788536 TAATAAGTACTGTTTATTGAGGG - Intergenic
1056382120 9:86064940-86064962 CAGTAAGTGCATCTGATTGGAGG - Intronic
1057735358 9:97653471-97653493 CAGGATGTACAGCTTTTTGAGGG - Intronic
1060624979 9:125103556-125103578 TAGTAAGGACCGCTTGTTGAGGG - Intronic
1060979332 9:127783685-127783707 TAGTAATGACAACTTATTGACGG - Intergenic
1186052328 X:5611437-5611459 CAGTAAGATCTGCTCATTGAGGG - Intergenic
1186489672 X:9961662-9961684 CAGTAAGTACATGTAATTGTTGG + Intergenic
1186635432 X:11399221-11399243 CAGTAATAACAGCCTATTCAAGG - Intronic
1187300040 X:18039541-18039563 CAGTAAGTACAGGCTGTGGATGG + Intergenic
1188349172 X:29105842-29105864 CAGCAGGTACAGCCCATTGATGG - Intronic
1189474306 X:41337464-41337486 CAGTAAGTACAACATCTTGTGGG + Exonic
1190267839 X:48838664-48838686 AAGTTATTACAGCTTATTAATGG + Intergenic
1191190386 X:57660270-57660292 CAGTCAGTACAGCTGATAGAAGG + Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1196514411 X:116552653-116552675 CAGTAAATACAACCCATTGAAGG - Intergenic
1197559714 X:128002926-128002948 CAGTATGAACTGCTTAGTGATGG + Intergenic
1197812953 X:130464504-130464526 CAGAAAATACAGCTTCTTGAGGG + Intergenic
1197899021 X:131348502-131348524 CAGAAAGTACCGCTCAATGAAGG - Intronic
1198572313 X:137971104-137971126 CAGTGGGTACAGCTTATGGAGGG + Intergenic
1198801713 X:140454268-140454290 CACTAAGTTGAGCTTAGTGAGGG + Intergenic
1199085904 X:143630638-143630660 CAGTTTGTGGAGCTTATTGAAGG + Exonic
1199185878 X:144914075-144914097 TAGTAAGTATAGCTAATAGAAGG - Intergenic