ID: 997258047

View in Genome Browser
Species Human (GRCh38)
Location 5:132444252-132444274
Sequence CTACTGGTGTGAAGCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997258047_997258053 -9 Left 997258047 5:132444252-132444274 CCGGCTGGGCTTCACACCAGTAG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 997258053 5:132444266-132444288 CACCAGTAGAGGGAACCTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 137
997258047_997258061 24 Left 997258047 5:132444252-132444274 CCGGCTGGGCTTCACACCAGTAG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 997258061 5:132444299-132444321 CTCAGCTTATGCTGAACTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 104
997258047_997258052 -10 Left 997258047 5:132444252-132444274 CCGGCTGGGCTTCACACCAGTAG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 997258052 5:132444265-132444287 ACACCAGTAGAGGGAACCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997258047 Original CRISPR CTACTGGTGTGAAGCCCAGC CGG (reversed) Intronic
903230885 1:21921740-21921762 CCACTTCTGTTAAGCCCAGCTGG + Intronic
903952272 1:27003057-27003079 CTGCTGGAGTGAAGCCCACCAGG + Intergenic
905322049 1:37124783-37124805 CGCCTGGTGTGAATCCCAGTGGG - Intergenic
906220928 1:44078752-44078774 CCACTGGTGTGGATGCCAGCAGG + Intergenic
906522668 1:46476701-46476723 CTCCTGTTGTGAAGCCCAGAAGG - Intergenic
907155581 1:52330775-52330797 CTCCTGGGATGCAGCCCAGCAGG + Intronic
909203510 1:72724941-72724963 CAGCTGATGTGGAGCCCAGCGGG + Intergenic
909467201 1:75985433-75985455 CAACTCGTGTGAAGTCCAGAGGG - Intergenic
913595697 1:120374248-120374270 ATTCTGGTGTGAGGCCCAGAAGG - Intergenic
914091578 1:144504728-144504750 ATTCTGGTGTGAGGCCCAGAAGG + Intergenic
914307022 1:146429447-146429469 ATTCTGGTGTGAGGCCCAGAAGG - Intergenic
914595084 1:149143664-149143686 ATTCTGGTGTGAGGCCCAGAAGG + Intergenic
915228247 1:154427190-154427212 TTACAGGTGTGAGGCCCAGCTGG + Intronic
915896488 1:159815237-159815259 CAGCTGGTGTGTAGTCCAGCTGG + Intronic
916076236 1:161201418-161201440 CTACGGGTGGGTGGCCCAGCTGG + Intronic
920681901 1:208079421-208079443 CTACAAGTGTGCAGCCCAGCGGG - Exonic
923012520 1:230099713-230099735 CTAGTGGTGTGCTGCCCACCAGG + Intronic
924674205 1:246159303-246159325 CTCCTGGTGTGTAGCTCACCGGG + Intronic
1067661876 10:48242195-48242217 CTTCTGATGTGGAGACCAGCAGG + Exonic
1067721659 10:48732041-48732063 CCACAGGTATGCAGCCCAGCAGG - Intronic
1069957953 10:72063070-72063092 CTGCTGGTGTGTGGACCAGCTGG - Exonic
1076199364 10:128546331-128546353 CTCCTCATGTGAAGCCCAGTAGG + Intergenic
1077196785 11:1285014-1285036 GTGCTGGTGTCCAGCCCAGCTGG - Intronic
1081353894 11:42089659-42089681 CTCTTTGAGTGAAGCCCAGCGGG - Intergenic
1081814761 11:45932366-45932388 CTCCTGTTGTGAAGCCCAAATGG - Intronic
1084277651 11:68062817-68062839 ATGCTGCGGTGAAGCCCAGCAGG + Intronic
1084483029 11:69432972-69432994 CACCTGGTGTGGAACCCAGCAGG + Intergenic
1085204016 11:74719470-74719492 CTCCTGGTGTGAAGATCACCAGG + Intronic
1085517998 11:77122488-77122510 CTACAGGTGAGATGCCCACCCGG - Intronic
1087195003 11:95296430-95296452 CCACTGGCCTGTAGCCCAGCAGG + Intergenic
1088901267 11:114119444-114119466 CTCCTGGTGGGAAATCCAGCAGG - Intronic
1091293443 11:134455469-134455491 CTATGGGAGTGCAGCCCAGCAGG - Intergenic
1091633546 12:2180350-2180372 CTTCTGCTAGGAAGCCCAGCAGG + Intronic
1097673134 12:62565798-62565820 CTACTGGTGTGAAGTTTAGTTGG + Intronic
1098089420 12:66885287-66885309 GAACTGGTGTGAAGCGCACCGGG - Intergenic
1100540093 12:95549035-95549057 CTACAGGTGCGAAGCCCGCCCGG - Intronic
1102236251 12:111296373-111296395 CTCCTTCTGCGAAGCCCAGCAGG - Intronic
1109362537 13:61314991-61315013 CTACAGGTGTGAACCACACCTGG + Intergenic
1111526415 13:89476665-89476687 CAGCTGATGTGAAGCCCAGAAGG - Intergenic
1113669462 13:112165821-112165843 CAGCTGATGTGAAGCCCAGTGGG + Intergenic
1114623872 14:24115759-24115781 CCTCTGGTGTGACCCCCAGCAGG + Intronic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1117246135 14:53888672-53888694 CTGCTGGGGTGAAGTCCAGCTGG - Intergenic
1118478488 14:66141177-66141199 CAGCTGATGTGAAGCCCAGAGGG + Intergenic
1119264350 14:73255186-73255208 CACCTGGTGTGCAGCCCACCAGG + Intronic
1125300947 15:38252833-38252855 CCACTGGGGTGGAGCGCAGCGGG - Exonic
1128221086 15:65969191-65969213 CTACTGGTATGGAGTCCAGCCGG + Intronic
1129418820 15:75406136-75406158 CTACCAGTGAGAAGCCCAACAGG + Intronic
1132743216 16:1426221-1426243 ATCCTGGTGTGCAGCCCAGGGGG + Intergenic
1134687679 16:16169987-16170009 CTTCTGGTGGGAGGCACAGCGGG - Intronic
1140747148 16:77990807-77990829 TTATTGTTGAGAAGCCCAGCAGG + Intergenic
1142270335 16:89085671-89085693 GTGCTGGTTTGAACCCCAGCTGG + Intergenic
1149407630 17:56370392-56370414 TTACTGGTGTGAATTCCAGGTGG - Intronic
1149805805 17:59616729-59616751 CCACTGATATGAATCCCAGCAGG - Intergenic
1153399345 18:4666533-4666555 CAGCTGGTGTGAAGCCCAAAGGG + Intergenic
1156707908 18:39905805-39905827 CAGCTAGTGTGAAGACCAGCAGG - Intergenic
1160010089 18:75100794-75100816 ATACATGTTTGAAGCCCAGCAGG + Intergenic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1160494930 18:79367736-79367758 CTCCTGCTGTGGAGCCCTGCAGG + Intronic
1163690527 19:18736068-18736090 CTGCTGGCGTGAAGCCCAGCTGG - Intronic
1164784308 19:30917825-30917847 CTGCTGAAGAGAAGCCCAGCAGG - Intergenic
1165090739 19:33387257-33387279 CTACTGGAGTGCTGACCAGCAGG + Exonic
1166266640 19:41688578-41688600 CTGCTGGGATGATGCCCAGCAGG + Intronic
925604385 2:5643601-5643623 ATTCTGGTGTGAGGCCCAGAAGG - Intergenic
929277703 2:40043638-40043660 CTCCTTGTGTGAAGCCCAGAAGG + Intergenic
930303682 2:49650367-49650389 CTACTGCTGAAAAGCCCAGAAGG + Intergenic
931011136 2:57915736-57915758 GTACTGGTCTGCAGCCCAGCGGG - Intronic
932832956 2:75008349-75008371 CTCCTGGTCTGAATCCCAGTGGG + Intergenic
935079377 2:99777358-99777380 CAACTGGCTTAAAGCCCAGCAGG - Intronic
936056308 2:109264474-109264496 CTAAGGGTAAGAAGCCCAGCAGG - Intronic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
939199768 2:139018779-139018801 CAGCTGATGTGAAGCCCAGAGGG - Intergenic
940314333 2:152311570-152311592 TTACAGGTGTGAATCCTAGCTGG - Intergenic
942537108 2:176976585-176976607 CTACTGATGTCAAGCTCAGGGGG + Intergenic
942567640 2:177282368-177282390 CTAATGGTGGGAAGTTCAGCTGG + Intronic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
945112018 2:206368984-206369006 ATACTGGTGTGAGGTCCAGGGGG + Intergenic
1171046111 20:21810273-21810295 CTGCTGGGGTGCAGCCCAGATGG - Intergenic
1179571912 21:42283494-42283516 CTGCTGGAGTAAAGCCCACCTGG + Intronic
1179987771 21:44930909-44930931 GGACTGCAGTGAAGCCCAGCTGG - Intronic
949802024 3:7914633-7914655 CCACTTGTGTCAAACCCAGCTGG + Intergenic
950013986 3:9743466-9743488 TTCCTGGTGAGAAGCCCAGGGGG + Intronic
955158599 3:56442556-56442578 GTACTGGTCTAAAGCCGAGCTGG - Intronic
955500614 3:59579094-59579116 GCACTGATGTGAAGCCCATCTGG + Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
960678616 3:120223172-120223194 CTACTGGGGTGAAGCAGAGCTGG - Intronic
960831625 3:121855583-121855605 CTTCTGGTGTGAATCACAGCAGG - Intronic
962373117 3:134837591-134837613 CTACTAGGGTGCAGCCCAGAGGG - Intronic
966035003 3:175401074-175401096 CTACTGGTGTGTATTCCAGTTGG - Intronic
966320898 3:178699792-178699814 CAGCTGATGTGAAGCCCAGAGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
971767162 4:30847367-30847389 CTTCTGGTGTGAAGCACAAAGGG - Intronic
972226493 4:37018817-37018839 CTACTGGTGTATGGCACAGCAGG + Intergenic
972883728 4:43458529-43458551 CACCTTGTGTGAAGCCCAGTGGG - Intergenic
974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG + Intergenic
980021121 4:127711525-127711547 CTACTGGTATGTGGCCCAGGGGG - Intronic
990494617 5:56335045-56335067 ATACAAGTCTGAAGCCCAGCAGG + Intergenic
991978194 5:72203725-72203747 CTGCTGCTGAGGAGCCCAGCCGG + Exonic
992091339 5:73320092-73320114 CAACAGTTGTGAAGACCAGCAGG - Intergenic
992258813 5:74949408-74949430 CCACAGTTATGAAGCCCAGCTGG + Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
997258047 5:132444252-132444274 CTACTGGTGTGAAGCCCAGCCGG - Intronic
1000969409 5:167697238-167697260 CTCCTTGTTTGAAGCTCAGCAGG + Intronic
1005464201 6:26095890-26095912 CACCGTGTGTGAAGCCCAGCAGG - Exonic
1010057761 6:71585731-71585753 CAACTGTATTGAAGCCCAGCTGG + Intergenic
1011348673 6:86399384-86399406 TTACAAGTGTGAAACCCAGCAGG + Intergenic
1012741918 6:103027919-103027941 CCCCTTGTGTGAAGCCCAGTAGG - Intergenic
1019735864 7:2649490-2649512 CTTCTGGCCTGCAGCCCAGCAGG + Intronic
1024264522 7:47596628-47596650 CTACTGGTGTGCTGGCCTGCTGG - Intergenic
1026291761 7:69013360-69013382 CTGATGGTGTAAATCCCAGCAGG + Intergenic
1034110733 7:148535416-148535438 CTCCGGGTGTGAAACCTAGCAGG - Intergenic
1035204411 7:157285720-157285742 CTCCTGGTGTGCAGCTCTGCAGG + Intergenic
1040980638 8:53242834-53242856 GGACTGGTGTGAAGCCGGGCAGG - Intronic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1044480269 8:92678828-92678850 CTGGTGGTTTGAAGCCCATCAGG - Intergenic
1046366170 8:113235783-113235805 CCCCTTGTGTGAAGCCCAGCAGG + Intronic
1047940522 8:129824046-129824068 ATACAGGTCTGAAACCCAGCAGG - Intergenic
1048414083 8:134207156-134207178 CTATTGGTGGGAAGATCAGCAGG + Intergenic
1049290405 8:141798580-141798602 CTGCTTGGGGGAAGCCCAGCAGG + Intergenic
1050333192 9:4565864-4565886 ATACTTGGGTGAAGCTCAGCAGG + Intronic
1055422862 9:76162222-76162244 CTACCAGTGTCAAGCACAGCAGG - Intronic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1059516448 9:114900371-114900393 CCATTGGTTGGAAGCCCAGCAGG + Intronic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188910644 X:35842945-35842967 CTACTGCTGTGTCTCCCAGCTGG + Intergenic
1191803997 X:65114097-65114119 CCACTGGAATGAAGCCCAGTAGG + Intergenic
1195941330 X:110170203-110170225 GTACTGGTGCAAAGCCCAGAAGG - Intronic
1199169271 X:144717412-144717434 CTCCTGGTGTGCAGGCCAGTTGG - Intergenic