ID: 997258203

View in Genome Browser
Species Human (GRCh38)
Location 5:132445386-132445408
Sequence GTGTGGTAGTAGCAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997258200_997258203 -6 Left 997258200 5:132445369-132445391 CCAGAGGTATGTCTAGGGTGTGG 0: 1
1: 0
2: 1
3: 6
4: 114
Right 997258203 5:132445386-132445408 GTGTGGTAGTAGCAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997258203 Original CRISPR GTGTGGTAGTAGCAGTGTGG AGG Intronic
No off target data available for this crispr