ID: 997262678

View in Genome Browser
Species Human (GRCh38)
Location 5:132476562-132476584
Sequence AGGACCCCATTTTTGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997262678_997262687 14 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262687 5:132476599-132476621 GGCAGGCCGCACAAGCTTGGGGG No data
997262678_997262680 -7 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262680 5:132476578-132476600 GGGTCCTCTTCAGTGACCTGAGG No data
997262678_997262682 -3 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262682 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
997262678_997262689 21 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262689 5:132476606-132476628 CGCACAAGCTTGGGGGTAGATGG No data
997262678_997262685 12 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262685 5:132476597-132476619 GAGGCAGGCCGCACAAGCTTGGG No data
997262678_997262686 13 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262686 5:132476598-132476620 AGGCAGGCCGCACAAGCTTGGGG No data
997262678_997262684 11 Left 997262678 5:132476562-132476584 CCAAAGACCAAAAATGGGGTCCT No data
Right 997262684 5:132476596-132476618 TGAGGCAGGCCGCACAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997262678 Original CRISPR AGGACCCCATTTTTGGTCTT TGG (reversed) Intergenic