ID: 997262679

View in Genome Browser
Species Human (GRCh38)
Location 5:132476569-132476591
Sequence ACTGAAGAGGACCCCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997262679_997262686 6 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262686 5:132476598-132476620 AGGCAGGCCGCACAAGCTTGGGG No data
997262679_997262689 14 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262689 5:132476606-132476628 CGCACAAGCTTGGGGGTAGATGG No data
997262679_997262687 7 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262687 5:132476599-132476621 GGCAGGCCGCACAAGCTTGGGGG No data
997262679_997262684 4 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262684 5:132476596-132476618 TGAGGCAGGCCGCACAAGCTTGG No data
997262679_997262682 -10 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262682 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
997262679_997262685 5 Left 997262679 5:132476569-132476591 CCAAAAATGGGGTCCTCTTCAGT No data
Right 997262685 5:132476597-132476619 GAGGCAGGCCGCACAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997262679 Original CRISPR ACTGAAGAGGACCCCATTTT TGG (reversed) Intergenic