ID: 997262681

View in Genome Browser
Species Human (GRCh38)
Location 5:132476582-132476604
Sequence CCTGCCTCAGGTCACTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997262681_997262690 23 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262690 5:132476628-132476650 GTCTCCTGTGCCCAGAACTCTGG No data
997262681_997262686 -7 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262686 5:132476598-132476620 AGGCAGGCCGCACAAGCTTGGGG No data
997262681_997262685 -8 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262685 5:132476597-132476619 GAGGCAGGCCGCACAAGCTTGGG No data
997262681_997262687 -6 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262687 5:132476599-132476621 GGCAGGCCGCACAAGCTTGGGGG No data
997262681_997262689 1 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262689 5:132476606-132476628 CGCACAAGCTTGGGGGTAGATGG No data
997262681_997262684 -9 Left 997262681 5:132476582-132476604 CCTCTTCAGTGACCTGAGGCAGG No data
Right 997262684 5:132476596-132476618 TGAGGCAGGCCGCACAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997262681 Original CRISPR CCTGCCTCAGGTCACTGAAG AGG (reversed) Intergenic