ID: 997263055

View in Genome Browser
Species Human (GRCh38)
Location 5:132478321-132478343
Sequence CGTGGTACACACGTGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997263050_997263055 -3 Left 997263050 5:132478301-132478323 CCGTGGTGGGGTGCCAGTGCCGT No data
Right 997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG No data
997263045_997263055 16 Left 997263045 5:132478282-132478304 CCTGGTCTGTGAACAAGGGCCGT No data
Right 997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997263055 Original CRISPR CGTGGTACACACGTGGTGCT TGG Intergenic
No off target data available for this crispr