ID: 997263055 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:132478321-132478343 |
| Sequence | CGTGGTACACACGTGGTGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 997263050_997263055 | -3 | Left | 997263050 | 5:132478301-132478323 | CCGTGGTGGGGTGCCAGTGCCGT | No data | ||
| Right | 997263055 | 5:132478321-132478343 | CGTGGTACACACGTGGTGCTTGG | No data | ||||
| 997263045_997263055 | 16 | Left | 997263045 | 5:132478282-132478304 | CCTGGTCTGTGAACAAGGGCCGT | No data | ||
| Right | 997263055 | 5:132478321-132478343 | CGTGGTACACACGTGGTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 997263055 | Original CRISPR | CGTGGTACACACGTGGTGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||