ID: 997264115

View in Genome Browser
Species Human (GRCh38)
Location 5:132485153-132485175
Sequence CTTTGGAAGGCGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318316
Summary {0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997264115_997264124 11 Left 997264115 5:132485153-132485175 CCACCCACCTTCGCCTTCCAAAG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
Right 997264124 5:132485187-132485209 CAGGCATGAGCCACTGCCCCCGG 0: 242
1: 13590
2: 54236
3: 120792
4: 147671
997264115_997264122 -8 Left 997264115 5:132485153-132485175 CCACCCACCTTCGCCTTCCAAAG 0: 4
1: 1069
2: 27256
3: 105944
4: 184043
Right 997264122 5:132485168-132485190 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997264115 Original CRISPR CTTTGGAAGGCGAAGGTGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr