ID: 997264217

View in Genome Browser
Species Human (GRCh38)
Location 5:132485775-132485797
Sequence GGGATCTGGTGGGCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997264217 Original CRISPR GGGATCTGGTGGGCTGGAAC TGG (reversed) Intronic
900318980 1:2073232-2073254 GGGCACTGGGGGGCAGGAACAGG - Intronic
900477462 1:2882616-2882638 GGCCTCTGCTGGGTTGGAACAGG + Intergenic
900824393 1:4914348-4914370 GGCACCTGGTGGGCAGGACCTGG + Intergenic
902142227 1:14366483-14366505 GGGAACTGGAGGGCGGGCACTGG + Intergenic
902621024 1:17651275-17651297 GGGATGTGTTGGGGTGGGACAGG + Intronic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
902707401 1:18215122-18215144 GGGATCTGGTGGGAGGTGACTGG - Intronic
902774237 1:18664411-18664433 GGGAGCTGGTGACCTGGAAGAGG + Intronic
904305715 1:29587649-29587671 GGGCTCTCGTGGGCAGGAATGGG - Intergenic
905145444 1:35883836-35883858 GGGCTCCGCTGGGCTGGAATAGG + Intronic
909304554 1:74056847-74056869 GGGACCTGGTGGGATGTAATTGG + Intronic
912381606 1:109250616-109250638 GGTAGCTGGGGGGCTGGAACTGG - Exonic
912644905 1:111383349-111383371 GGGATTTGGTGGGCCCAAACAGG - Intergenic
912798013 1:112704666-112704688 GGGACCGGGTGGGGTGGACCAGG - Intronic
912799973 1:112714533-112714555 GGGAACTGGGGCGCTGGAGCCGG + Intronic
913051341 1:115119453-115119475 GGGACCTGGTGGGAGGTAACTGG - Intergenic
915097570 1:153474243-153474265 GGGCTCTGGTGGGCTGATCCTGG - Intergenic
915766346 1:158366186-158366208 GGGACCTGGTGGGAGGTAACTGG + Intergenic
916433987 1:164759722-164759744 GGGACATGGAGAGCTGGAACTGG + Intronic
917529060 1:175816855-175816877 GAGATCTGATTGTCTGGAACTGG + Intergenic
919727809 1:200895227-200895249 GGGTGCTGGTGGGCTTGGACGGG + Intronic
919916447 1:202142626-202142648 GGGACCTTGTGGGCTGGAGATGG + Intronic
921330068 1:214026796-214026818 CGGATCTGGGGGGCTGCTACCGG - Intronic
921931484 1:220757844-220757866 GGGCTCTGGTGGGCTGGCTGTGG - Intronic
921944058 1:220874451-220874473 CGGGCCTGGTGGGCTGGGACAGG + Intergenic
922081366 1:222300390-222300412 GGGACCTGGTGGGAGGTAACTGG - Intergenic
923252485 1:232190404-232190426 GGGATCTGGAGGGCTCTAAGTGG + Intergenic
924116371 1:240751909-240751931 GGGTCCTGGTGGGCGGTAACTGG + Intergenic
1062800666 10:377274-377296 GGGAGGTTATGGGCTGGAACTGG + Intronic
1063922483 10:10946040-10946062 GGGAACAGGTGCTCTGGAACTGG + Intergenic
1067474585 10:46557146-46557168 GGGGTCTCGTGGGCGGGATCTGG - Intergenic
1067685198 10:48462708-48462730 GGGACCTGGTGGGCAAGACCAGG + Intronic
1073101409 10:101008597-101008619 GGGAGCCAGTGGGCAGGAACTGG + Intronic
1073859500 10:107721464-107721486 GGGACCTGGTGGGATGTGACTGG + Intergenic
1074037750 10:109757737-109757759 GGGACCTGGTGGGAGGTAACTGG + Intergenic
1074761524 10:116670289-116670311 GGAAGCGGGTGGGCGGGAACAGG + Intergenic
1076505314 10:130968805-130968827 GGGATCTCTGGGGCTGAAACAGG + Intergenic
1077632425 11:3819776-3819798 GGGAACTTGTGTGCTGGAATGGG + Intronic
1079562854 11:21844438-21844460 GGGACCTGGTGGGAGGTAACTGG + Intergenic
1080000396 11:27341880-27341902 GGGACCTGGTGGGAGGTAACTGG + Intronic
1081968732 11:47184828-47184850 GGGAACTCGGAGGCTGGAACAGG - Intronic
1081993706 11:47350809-47350831 GGGAACTGATGGCCTGGGACGGG - Intronic
1084209619 11:67614994-67615016 GGGAGCTGGAGGGGAGGAACAGG - Intergenic
1084409302 11:68997166-68997188 GGGTTCTTGTGGGCTGGGAAAGG + Intergenic
1084529177 11:69717056-69717078 GGGATGTGGGGGGCTGGACTAGG + Intergenic
1084872054 11:72105049-72105071 GTGATGCGGTGGGCTTGAACTGG - Intronic
1085646463 11:78226692-78226714 GGGATCTGGTAGGCTGAGAGTGG + Exonic
1086821720 11:91443714-91443736 GGGACCTGGTGGGATGTGACTGG - Intergenic
1088373211 11:109113746-109113768 GGGATTTGGGGTGCTGGAAGTGG + Intergenic
1088747247 11:112814476-112814498 GGGGTCTGGTGAGCTGGTAGTGG - Intergenic
1090782055 11:130015908-130015930 GGGACCTGGTGGGAGGTAACTGG + Intergenic
1091693475 12:2612386-2612408 TGGATCTGGGGGGCTGGGCCTGG - Intronic
1092764958 12:11844423-11844445 AGGTTCTGGTGGGTTGGAAAGGG - Intronic
1095540227 12:43301173-43301195 GGGACCTGGTGGGAGGTAACTGG + Intergenic
1095953664 12:47794988-47795010 GGGAGGTGGTGGGCTGGGCCAGG + Intronic
1096258853 12:50078666-50078688 GGGATGGGGTGGGCTGGAACTGG - Intronic
1099740193 12:86624974-86624996 GGGATCTGGTGGGAGGTGACTGG + Intronic
1101586174 12:106087940-106087962 TGGACCTGGTGGCCGGGAACCGG - Intronic
1102012237 12:109625840-109625862 GGCATCTGGTGGGCGGGGGCTGG - Intergenic
1103341640 12:120224168-120224190 GGGAGCTGCTGGGCTGCCACTGG + Exonic
1103478893 12:121238218-121238240 GGCAGCTGGTGGGATGGAAGGGG + Exonic
1103993581 12:124815020-124815042 GGGACTTGGAGGGCTGGAACTGG + Exonic
1110218909 13:73052154-73052176 GGGAGCTGGGGGGTGGGAACGGG + Intergenic
1110392006 13:74984778-74984800 GGGATCTGGTGGGAGGTGACTGG - Intergenic
1110472506 13:75876045-75876067 GGGGTGTGGTGGGCTGGGAATGG - Intronic
1111912001 13:94323173-94323195 TGCATCTGGTGGGCTGGGGCAGG - Intronic
1112610410 13:100949607-100949629 GGAATCTGGAGGGATGGAGCAGG - Intergenic
1113047092 13:106167928-106167950 GGAATCTGGTGCTCTGGAAACGG - Intergenic
1114665699 14:24376135-24376157 GGGATATGGGGAGCTGGAGCAGG + Intronic
1116516103 14:45807761-45807783 GGGATCTGGTGGGAGGTGACTGG + Intergenic
1119241470 14:73063672-73063694 GAGAGATGGTGGCCTGGAACAGG - Intronic
1119466671 14:74863676-74863698 GGGGTCTGTAGGGCTGGAGCTGG + Exonic
1119480265 14:74954334-74954356 GGGAGCTGAGGGGCTGGAGCGGG + Intronic
1119896196 14:78221757-78221779 TGGAACTGGTGGGCTAGAACAGG + Intergenic
1122218202 14:100218267-100218289 GGGCTTTGCTGGGCTGCAACAGG - Intergenic
1122290662 14:100678745-100678767 GTGAGCTGCTGGGCTGGAGCAGG + Intergenic
1122327879 14:100893382-100893404 GGGATCGGGTGGGCAGGCAGGGG - Intergenic
1122880628 14:104689199-104689221 CGGATCCGGCTGGCTGGAACGGG + Intergenic
1124333097 15:28837198-28837220 TGGGTCTGGAGGGCTGGAGCAGG - Intergenic
1124372658 15:29112174-29112196 GGGAGCTGGTGGGCAGGGACTGG + Intronic
1125124848 15:36208290-36208312 GGGAACTAGTGGCCTGGAAAGGG - Intergenic
1125460901 15:39905806-39905828 GGGATCGGGTGGGAGGGAAATGG + Intronic
1128272755 15:66326095-66326117 CGGATGTGGTGCCCTGGAACTGG + Exonic
1128549908 15:68591379-68591401 GGGTGCTGCTGGGCTGGAAATGG + Intronic
1129058042 15:72836106-72836128 GGGATCTGGTGGGAAGTGACAGG - Intergenic
1129388944 15:75210950-75210972 GGGGCCAGGTGGGCTGGCACTGG - Exonic
1129878307 15:78991509-78991531 AGAATTTGGTGGGCAGGAACGGG + Intronic
1130977164 15:88785469-88785491 AGGATCTGGTGGGGTGCAGCTGG + Intergenic
1132385359 15:101396580-101396602 GCGATCTAGTGGGTTGGAGCTGG + Intronic
1132800171 16:1748142-1748164 TGAGTCTGGTGGGCTGGAGCTGG - Intronic
1133320194 16:4909026-4909048 GGGAGCTGATGGGAGGGAACAGG + Intronic
1133748409 16:8705366-8705388 GGGATCTGGTGGGAGGTGACTGG - Intronic
1134327712 16:13222183-13222205 GGGACCTGGTGGGAGGGACCTGG - Intronic
1134686440 16:16161932-16161954 GGGATCTGGTGGGAGGTGACTGG + Intronic
1135021925 16:18970091-18970113 GGGACCTGGTGGGAGGCAACTGG - Intergenic
1135128580 16:19832932-19832954 GGGATCTGGTGGGAGGTGACTGG - Intronic
1135169538 16:20171076-20171098 GGGACCTGGTGGGAAGTAACTGG + Intergenic
1135653259 16:24225557-24225579 GGTATCTGGTGGGTGGGAAGGGG + Intergenic
1136556052 16:31008460-31008482 GGGATCAGGTGGTGTGGAATTGG - Intronic
1136933341 16:34437281-34437303 GGCCTCTCGGGGGCTGGAACGGG - Intergenic
1136971231 16:34974533-34974555 GGCCTCTCGGGGGCTGGAACGGG + Intergenic
1138800249 16:60017869-60017891 GGGATCTGGTGGGAGGTGACTGG - Intergenic
1140124582 16:72108841-72108863 GGGAGCTGGTGGGGTGCAAGTGG - Exonic
1140488070 16:75309851-75309873 TGGTTCTGTTGGTCTGGAACTGG - Intronic
1141481904 16:84312320-84312342 GGAATCTGGTGGGCAGTGACTGG - Intronic
1142034283 16:87854107-87854129 GGGAGCGGCTGGGTTGGAACTGG - Intronic
1142399570 16:89852169-89852191 GGGATCTGGTGGGTGGGGAGAGG - Intronic
1142399615 16:89852286-89852308 GGGATCTGGTGGGTGGGGAGAGG - Intronic
1142399678 16:89852442-89852464 GGGATCTGGTGGGTGGGGAGAGG - Intronic
1142696097 17:1634761-1634783 GGGTTCTGGTGGCCTGGAGATGG + Exonic
1143715067 17:8761553-8761575 TGGATCTGGAGGCCTGAAACGGG + Intergenic
1144142634 17:12364399-12364421 GGGATCTGGTGGGAGGTGACTGG - Intergenic
1146128380 17:30248273-30248295 GGGATTGGGTGGGCAGGAAAAGG - Exonic
1148147327 17:45373990-45374012 GGGAACTGCTGGGTTGGAAGGGG - Intergenic
1148619449 17:49023200-49023222 GGCATCTGGGGACCTGGAACTGG + Intronic
1149825692 17:59825695-59825717 GGGATGGTGTTGGCTGGAACAGG + Intronic
1150229077 17:63540045-63540067 GGGATCTGCCGGACTGGCACAGG - Intronic
1150628249 17:66857839-66857861 GGGATGGAGTGGGCTGGGACCGG - Intronic
1151415378 17:73958818-73958840 GGGAGCTGGTCGCCTGGACCAGG - Intergenic
1152268436 17:79309690-79309712 GGGACCTGGTGGGAGGTAACTGG + Intronic
1153296434 18:3551029-3551051 TGGTTCTGGTGGGCTGGACGTGG - Intronic
1153506476 18:5804274-5804296 GGGATCTGGTGGGAGGTAATTGG + Intergenic
1155289528 18:24326663-24326685 GGCATCAGATGGGATGGAACTGG - Intronic
1156371390 18:36474574-36474596 GGGATCAGGAGGGCCGAAACTGG + Intronic
1156448323 18:37253047-37253069 GGGAACACGTGGGCTGGAAGAGG + Intronic
1156472088 18:37383802-37383824 GGGCTCTGGTGGGCTAGTCCAGG + Intronic
1158182936 18:54738356-54738378 GGGATCTGGTGGGAGGTGACTGG + Intronic
1160384048 18:78483689-78483711 GGCATCTGGTGGGTGGGACCAGG + Intergenic
1160674132 19:379835-379857 GGGAGCTGGTGAGCTGTGACTGG + Intergenic
1160674144 19:379877-379899 GGGACCTGGTGAGCTGTGACTGG + Intergenic
1161489070 19:4551972-4551994 GGGAACTGGTAGGATGGATCAGG - Intronic
1161723211 19:5914930-5914952 GGGACATGGGGGGCTGGGACAGG - Exonic
1161928032 19:7315956-7315978 GGAATCTTGTGGTCTGGTACGGG + Intergenic
1162668894 19:12237992-12238014 GGAAGCTACTGGGCTGGAACAGG + Intronic
1162821597 19:13226615-13226637 GGGATCTGGAGGGGTGGCCCGGG + Intronic
1162901240 19:13796353-13796375 GGGATCTGGAGAGCAGGAATGGG - Intronic
1163159058 19:15454107-15454129 GGGGTCTGATGGGTGGGAACAGG - Intronic
1164671671 19:30076119-30076141 GTGATCTGGGGGGCTGGGAGTGG + Intergenic
1164870647 19:31640385-31640407 GGGATCTGGAGGGAGGGAAAAGG + Intergenic
1164870748 19:31640742-31640764 GGGATCTAGTGGGAGGGAAATGG + Intergenic
1165160098 19:33810999-33811021 GGGCTCAGGGGGGCTGGCACAGG + Intronic
1165845591 19:38816026-38816048 GGGACCGGGTGGGCTGGGAAGGG + Intronic
1166926394 19:46271756-46271778 GGGACCTGGTGGGAGGGGACTGG - Intergenic
1166984739 19:46652997-46653019 GGAGTCTGGGGGCCTGGAACAGG - Exonic
1168562460 19:57395668-57395690 GGGACCTGGTGGGATGTGACTGG - Intronic
1202646996 1_KI270706v1_random:152412-152434 GGGTTCTCCTGGGCTGGCACGGG + Intergenic
925057943 2:869710-869732 GGGACCTGGTGGGAGGTAACTGG + Intergenic
925064978 2:922510-922532 GGGAGCTGGTGGGCCTGGACTGG + Intergenic
927718563 2:25368250-25368272 GGGAGCTGTGGGGCTGGGACTGG + Intergenic
928102121 2:28444932-28444954 AGGAGCTGGTGGGGAGGAACTGG + Intergenic
928231199 2:29500190-29500212 GGGACCTGGTGGGAGGCAACTGG + Intronic
928783119 2:34848801-34848823 GGAAGCTGGTGGTCTGGAGCAGG - Intergenic
934952679 2:98589030-98589052 GGCATCAGGTAGGGTGGAACTGG + Exonic
934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG + Intergenic
935425669 2:102916360-102916382 GGGATCTGGTGGGAGGTGACTGG - Intergenic
942392522 2:175510495-175510517 GGGAGATGGTGGGCAGGAGCTGG - Intergenic
945448597 2:209967326-209967348 GGGAGTTGGTGGTCTGGAAGGGG + Intronic
946160692 2:217834305-217834327 GGGATCAGGTTGGCTGGGCCTGG - Intronic
947133388 2:226952922-226952944 GGGATGGGGTGGGATGGGACAGG + Intronic
947274960 2:228380209-228380231 GGGATCTGGTGGGAGGTAATTGG + Intergenic
947559785 2:231138821-231138843 GGGATATGCTGTGCTGGTACAGG + Exonic
947736910 2:232459839-232459861 TGGATCTGGTGACCTGGAATGGG - Exonic
948691969 2:239711797-239711819 GGGGCCAGGAGGGCTGGAACGGG - Intergenic
1168877344 20:1180772-1180794 GGGGTCAGGTGGGCGGGAGCAGG + Exonic
1169431873 20:5543667-5543689 GGGAGATGATAGGCTGGAACAGG - Intergenic
1171180115 20:23085562-23085584 AGGAACTGGTGGTCTGGAAGGGG + Exonic
1172191736 20:33065868-33065890 GGCCTCTGGGAGGCTGGAACAGG + Intronic
1172756709 20:37290283-37290305 GGTAGCCGGTGGGCTGAAACTGG - Intronic
1172835386 20:37869924-37869946 GGGATCTGGTGGGAGGGGAAGGG - Intronic
1173724508 20:45288013-45288035 GGGATGAGGTGGGCTGGAGATGG + Intergenic
1174036729 20:47673119-47673141 GGGATCCAGGAGGCTGGAACTGG - Intronic
1174873365 20:54204071-54204093 GGGAGCTGCTGGGGTGGAGCAGG - Intergenic
1175227610 20:57453924-57453946 GGCATCTGCTGGCCTGGAAGAGG - Intergenic
1175600235 20:60266956-60266978 GGGCTCTGATGGGCTGGGGCTGG - Intergenic
1175690269 20:61060317-61060339 GGCGTCTGGGTGGCTGGAACTGG - Intergenic
1176074052 20:63240504-63240526 GGCAGCTCGTGGTCTGGAACAGG - Exonic
1176199755 20:63854969-63854991 GGGCTGTGGTGGGCTTGACCTGG + Intergenic
1178058882 21:28830242-28830264 GGGATCTGGTGGGAGGTAATTGG + Intergenic
1178148099 21:29763125-29763147 GGGATCTGGTGGGAAGTGACTGG + Intronic
1179597388 21:42452065-42452087 TGGAGGGGGTGGGCTGGAACTGG - Intergenic
1180620439 22:17158614-17158636 GGGAGCAGGAGGGCTGGAGCCGG - Intronic
1181574820 22:23787109-23787131 GGGATCAGGAGGGCTGGGGCGGG - Exonic
1183990245 22:41593136-41593158 GGGATCTGGTGCGGTGGGTCAGG - Intergenic
1184346049 22:43913754-43913776 GGGCTCTGGGGAGGTGGAACTGG - Intergenic
1184744767 22:46449858-46449880 GGAATCTGATGGGGTGGAAAGGG - Intronic
1184973975 22:48047803-48047825 TGGCTCCGCTGGGCTGGAACAGG + Intergenic
1184986643 22:48140487-48140509 GGGGTCTGGTGTGCAGGCACAGG - Intergenic
1185043665 22:48518212-48518234 GGGATCTGGGTGTCTGGACCTGG + Intronic
1185409335 22:50674183-50674205 GGGGTCTGGGGGGCTGTGACGGG - Intergenic
949196555 3:1316529-1316551 GGGATCTGGTGGGAGGTGACTGG - Intronic
950207934 3:11094333-11094355 GGGACCTGGTGCCCTGGAGCAGG - Intergenic
950245984 3:11418978-11419000 GGGACCTGGTGGGCGGTGACTGG - Intronic
950535475 3:13575839-13575861 GGGAGGTGGTGGGCTGGGATGGG - Intronic
950833053 3:15894014-15894036 GGGAGCAGCTGTGCTGGAACTGG + Intergenic
951474912 3:23094492-23094514 GGGATGGGGTGGGGTGGGACAGG + Intergenic
952737788 3:36707411-36707433 GGGATCAGGTGAGGTGGATCAGG - Intergenic
955798561 3:62662883-62662905 GCCATCTGGAGGGCTGGTACAGG - Intronic
956765335 3:72480013-72480035 GGGATCTGGTGGGAAGGGATTGG + Intergenic
957411129 3:79841664-79841686 GGGATCTGGTGGGAGGTAATTGG + Intergenic
957793392 3:84968418-84968440 GGGATCATGTGGGATAGAACAGG + Intronic
958596627 3:96233982-96234004 GGGATCTGGTGGGAGGTGACTGG + Intergenic
958762674 3:98327718-98327740 GGGTTTCCGTGGGCTGGAACAGG + Intergenic
960005516 3:112777269-112777291 GGGATCTGGTGTGCAGGCAGTGG + Intronic
961411664 3:126726720-126726742 GGGAGGTGGTGGGCTGGAGGTGG + Intronic
963565652 3:146926966-146926988 TGGATCTGGTGAACTGGAAGGGG - Intergenic
966703981 3:182890258-182890280 GGACTCTGGTGGACTGGAAATGG + Intronic
967348177 3:188481986-188482008 GGGATCTGGTGGGAGGGGATTGG + Intronic
969334767 4:6501290-6501312 GGGACCTGATGGGCTGGCACAGG + Intronic
969617963 4:8264835-8264857 GGGACGGGGTGGGCTGGAAATGG + Intergenic
970672231 4:18410211-18410233 GGGATCTGGTGGGAGGTGACCGG + Intergenic
973531937 4:51843627-51843649 GGGATGTGGGGGGGTGGCACCGG + Intronic
973821990 4:54669997-54670019 GGGACATGGTGGGATGGAGCTGG - Intronic
974156018 4:58073789-58073811 GGGGTCTGGTGGGATGGGACTGG + Intergenic
975827656 4:78336778-78336800 GGGATGTGAAGGGCTGGAGCTGG - Intronic
979969391 4:127115112-127115134 GGGATCTGGTGGGAGGTGACTGG + Intergenic
980257651 4:130402941-130402963 GGGATCTGGTGGGAGGTGACTGG - Intergenic
980277738 4:130676903-130676925 GGGATCTGGTGGGAGGTGACTGG + Intergenic
980963074 4:139495665-139495687 GGGATCTGATGGGAGGTAACTGG - Intergenic
981356750 4:143798397-143798419 GGGATCTGGTGGGATGTGATTGG - Intergenic
982115746 4:152097010-152097032 GGGCTCTGCTGGGCTGGTGCTGG + Intergenic
983085163 4:163434251-163434273 GGGAACTGGTTGACTGGAGCAGG + Intergenic
985045940 4:185940431-185940453 GGGAGGTGGTGAGCTGCAACAGG - Intronic
985304456 4:188522862-188522884 GGGATCTGGTGGGAGGTGACTGG + Intergenic
985578118 5:683038-683060 GGGTTGTGCTGGGCTGGACCAGG + Intronic
985593045 5:775179-775201 GGGTTGTGCTGGGCTGGACCAGG + Intergenic
985658647 5:1144689-1144711 GTGATCTGTTGGTCTGGAAGTGG - Intergenic
985856888 5:2435291-2435313 GGGCTCTGGTGGGATGGAGAAGG - Intergenic
989520090 5:42391538-42391560 GGGACCTGGTGGGAGGTAACTGG - Intergenic
990133627 5:52618811-52618833 GGGACCTGGTGGGAGGGGACTGG + Intergenic
992198374 5:74361587-74361609 GGGATGTGGCGGGGTGGAGCAGG + Intergenic
993902842 5:93596084-93596106 GGGGTGGGGTGGGCTGCAACCGG + Intergenic
995768592 5:115645673-115645695 GGGATCTGGTGGGAGGTGACTGG - Intergenic
996093878 5:119377949-119377971 GGGATGTGGTAAGCTGGAAAGGG + Intronic
997264217 5:132485775-132485797 GGGATCTGGTGGGCTGGAACTGG - Intronic
1000577098 5:162988142-162988164 GGGACCTGGTGGGAGGGACCTGG - Intergenic
1003290456 6:4775648-4775670 GGGATCCGGGGGGCGGGAGCCGG - Intronic
1005948000 6:30609047-30609069 GGGATCTGGATGGTTGGAATGGG - Intronic
1006101535 6:31688962-31688984 GGGAAGGGGTGGGCTGGAACTGG - Intronic
1007488663 6:42200638-42200660 GGGATCTGCTGCGGTGGACCAGG - Intergenic
1007705245 6:43786893-43786915 GGGGTCTTGTTGGCTGCAACAGG + Intergenic
1009033385 6:58087307-58087329 GGGATCTGGTGGGAGGTCACTGG - Intergenic
1009208998 6:60839076-60839098 GGGATCTGGTGGGAGGTCACTGG - Intergenic
1009591004 6:65671125-65671147 AGGATGTGGGAGGCTGGAACAGG - Intronic
1011046652 6:83091210-83091232 GGGACCTGGTGGGAGGTAACTGG - Intronic
1011218763 6:85032747-85032769 GGGATCTGGTGGGAGGTAATTGG - Intergenic
1012080833 6:94756503-94756525 AGTTTCTGGTGGACTGGAACTGG + Intergenic
1013187292 6:107770900-107770922 TGCATCTGGAGGGCTGGAGCAGG - Intronic
1013606393 6:111752898-111752920 GTGAACTGGTGGAATGGAACTGG + Intronic
1015128689 6:129785369-129785391 TGGAGGTGGTGGTCTGGAACAGG + Intergenic
1015178475 6:130337152-130337174 GGGATCTGGTGGGAGGTGACTGG + Intronic
1018246955 6:161832843-161832865 GGCATCTAGTGGGCAGGAGCGGG - Intronic
1019058079 6:169237053-169237075 GGGCTGGGCTGGGCTGGAACAGG + Intronic
1019190301 6:170247062-170247084 GGGGCCTGGAGGGCTGGAGCTGG - Intergenic
1019299361 7:295717-295739 GGCCCCTGGTGGGCTGGGACTGG + Intergenic
1019389432 7:777568-777590 GGGATGGGGTGGGCGGGAAGCGG + Intronic
1019739771 7:2666778-2666800 GGGATCGGGAGGGCAGGGACAGG + Intergenic
1019778134 7:2924426-2924448 GGGACCTGCTGGGCTGGTCCCGG + Intronic
1020023680 7:4883757-4883779 GAGAACAGGTGGGCTGGAGCTGG + Intergenic
1020070296 7:5223027-5223049 CGGAGCTGGAGAGCTGGAACAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022706138 7:32803679-32803701 GGGATCTGGTGGGAGGTGACTGG - Intergenic
1022846704 7:34217055-34217077 GGGATCTGGTGGGAGGCAATTGG - Intergenic
1024054645 7:45652209-45652231 GGGACCTGGTGGGAGGTAACTGG - Intronic
1026493152 7:70880489-70880511 GGGATGGGGTGGGCTGGAGGTGG - Intergenic
1026649248 7:72200566-72200588 TGGAGCTGGTGGGGTGGAGCTGG + Intronic
1027874374 7:83749832-83749854 GGGACGTGGTGGGCTGGTGCTGG + Intergenic
1028289008 7:89041625-89041647 GGGATTTGGTGGGATGGGGCTGG + Intronic
1029634796 7:101776671-101776693 GTGATCTGGAGGGCTAGACCTGG + Intergenic
1031178458 7:118383360-118383382 GGGACCTGGTGGGAGGCAACTGG + Intergenic
1032560201 7:132882926-132882948 GGGACCTGGTGGGAGGTAACTGG + Intronic
1033596978 7:142865598-142865620 GGCCTCTGGTGGGTCGGAACTGG - Exonic
1034190000 7:149206639-149206661 GGGAGGTGGTGGGGAGGAACAGG + Intronic
1035433007 7:158836474-158836496 GGGGTCTGGTGGGAGGTAACTGG + Intergenic
1035567588 8:651624-651646 GAGAGCTGGTGGGCAGGGACAGG + Intronic
1036132475 8:6128627-6128649 GGGATCTGGTGGGAGGGGATTGG + Intergenic
1036263752 8:7259266-7259288 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036265052 8:7266888-7266910 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036266353 8:7274510-7274532 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036267655 8:7282132-7282154 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036268958 8:7289754-7289776 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036301546 8:7572621-7572643 GGGGTCTGGAGGCCTGGAGCAGG + Intergenic
1036302844 8:7580270-7580292 GGGGTCTGGCGGCCTGGAGCAGG + Intergenic
1036315792 8:7717805-7717827 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036317101 8:7725453-7725475 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036318410 8:7733101-7733123 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036319719 8:7740748-7740770 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036321026 8:7748396-7748418 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036322334 8:7756044-7756066 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036323643 8:7763692-7763714 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036324942 8:7771340-7771362 GGGGTCTGGCGGCCTGGAGCAGG - Intergenic
1036351096 8:8012968-8012990 GGGGTCTGGCGGCCTGGAGCAGG + Intergenic
1036352399 8:8020614-8020636 GGGGTCTGGAGGCCTGGAGCAGG + Intergenic
1036664824 8:10731231-10731253 GGGAGCTGGAGGCCTGGACCCGG - Intronic
1036958393 8:13215935-13215957 GGGATCTGGTGGGCACTAAATGG - Intronic
1037331241 8:17745885-17745907 GGGACCTGGTGGGAGGTAACTGG + Intronic
1040014874 8:42691865-42691887 CTGATCCGGTGGTCTGGAACAGG - Intergenic
1041338703 8:56817959-56817981 GGGATCTGGTGGGAGGTGACTGG + Intergenic
1041529627 8:58850380-58850402 GGGATTTTGTGGGCAGGAATAGG + Intronic
1041927432 8:63251138-63251160 GGGACCTGGTGGGAGGTAACTGG + Intergenic
1042056850 8:64773028-64773050 GGGATCTGGAGTTCTGGAAGTGG - Intronic
1042196604 8:66236628-66236650 GGGAGGTGGAGGGCTAGAACAGG + Intergenic
1043779594 8:84314219-84314241 GGGATCTGGTGGGAGGTGACTGG - Intronic
1043917611 8:85940720-85940742 TGGATCATGTGGGCTGTAACCGG + Intergenic
1047300644 8:123611007-123611029 TGCATCTGGTTGGCTGGAACTGG + Intergenic
1047482631 8:125299552-125299574 GGGACCTGGTGGGAGGTAACTGG - Intronic
1048527455 8:135216157-135216179 GGGACCTGGTGGGAGGTAACTGG - Intergenic
1050634223 9:7593111-7593133 GGGATCTGGTGGGAGGTAATTGG + Intergenic
1051386580 9:16515481-16515503 GGGAGTTGGTGGGATAGAACAGG - Intronic
1053131504 9:35618163-35618185 GGGATCTGTGGGGCGGGAAGTGG + Intronic
1053444363 9:38140370-38140392 GTGATCTGGAGGGCTGGAGAAGG - Intergenic
1053616538 9:39771765-39771787 GGGAACTGGTGGGAGGTAACTGG - Intergenic
1053874704 9:42531074-42531096 GGGAACTGGTGGGAGGTAACTGG - Intergenic
1053897910 9:42763515-42763537 GGGAACTGGTGGGAGGTAACTGG + Intergenic
1054236980 9:62570624-62570646 GGGAACTGGTGGGAGGTAACTGG + Intergenic
1054267630 9:62935681-62935703 GGGAACTGGTGGGAGGTAACTGG + Intergenic
1054551117 9:66605135-66605157 GGGAACTGGTGGGAGGTAACTGG + Intergenic
1057133196 9:92669180-92669202 GGAATGTGGCCGGCTGGAACGGG - Intronic
1058223143 9:102326725-102326747 GGGACCTGGTGGGATGTAATTGG + Intergenic
1059416812 9:114167628-114167650 GGGGTGGGGTGGGCTGGAGCAGG + Intronic
1059651219 9:116318121-116318143 GGGCTCTGGAGAGCAGGAACTGG - Intronic
1060268217 9:122124582-122124604 GGGATGTGGTGGCCTGGACCAGG - Intergenic
1062539885 9:137036888-137036910 GGGAGCTGGTGGGCCTGAGCTGG - Exonic
1062592340 9:137280015-137280037 GGGACCTTGTGGGCTGGTGCAGG + Exonic
1186084970 X:5977616-5977638 GGTATCTGGTGGGTGTGAACTGG + Intronic
1188813290 X:34680018-34680040 GGGATCTGGTGGGAGGTGACGGG - Intergenic
1189282241 X:39827107-39827129 GGGCTCTTGTGCGCTGGAGCCGG + Intergenic
1190180903 X:48191449-48191471 GGGATCCCCTGGGCTGGGACTGG + Intronic
1190183375 X:48213612-48213634 GGGATCCCCTGGGCTGGGACGGG - Intronic
1190189231 X:48262584-48262606 GGGATCCCCTGGGCTGGGACTGG - Intronic
1190199830 X:48351316-48351338 GGGATCCCCTGGGCTGGGACTGG + Intronic
1190204076 X:48388135-48388157 GGGATCCCCTGGGCTGGGACGGG - Intronic
1190206460 X:48407268-48407290 GGGATCCCCTGGGCTGGGACGGG + Intronic
1190466011 X:50725521-50725543 GGGACCTGGTGGGAGGTAACTGG + Intronic
1190480389 X:50871012-50871034 GGGTTCTGGATGGCTGTAACAGG - Intergenic
1190657991 X:52629066-52629088 GGGATCCCCTGGGCTGGGACTGG - Intergenic
1190666608 X:52701797-52701819 GGGATCCCCTGGGCTGGGACTGG + Intronic
1190672810 X:52756611-52756633 GGGATCCCCTGGGCTGGGACTGG - Intronic
1192138693 X:68630140-68630162 GGAATCTGGAGGGCAGGAATGGG - Intergenic
1192147090 X:68689153-68689175 GGAATCTGGAGGGCAGGAATGGG + Intronic
1193950065 X:87786561-87786583 GGGACCTGGTGGGAGGTAACTGG - Intergenic
1194662877 X:96646044-96646066 GGGGATTGGTGGGCTGGGACGGG - Intergenic
1199846469 X:151695441-151695463 GGGAGCAGGTGGGCGGGGACAGG + Intronic
1200064444 X:153497770-153497792 GGGATCTTCTGGCCTGGAAGGGG - Intronic
1200126051 X:153815651-153815673 GGGACCTGGCGGCCTGGAAGGGG + Intronic
1201104980 Y:10756778-10756800 GGGGTGTGGTGGGGTGGAATGGG - Intergenic