ID: 997264347

View in Genome Browser
Species Human (GRCh38)
Location 5:132486439-132486461
Sequence CAGGCTGCAGGGTTGGTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997264347 Original CRISPR CAGGCTGCAGGGTTGGTCGG AGG (reversed) Intronic
900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900090863 1:919848-919870 CAGGCCGCAGTGTTGGCAGGGGG + Intergenic
900164621 1:1239763-1239785 CGAGCTGGAGGGTTGGTGGGGGG + Intergenic
900164656 1:1239866-1239888 CAGGCAGCAGGGTCGGCCTGCGG + Intergenic
900209162 1:1445018-1445040 TGGGGTGCAGGGGTGGTCGGGGG + Intergenic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900541624 1:3205845-3205867 CCGGCTTCAGGGTTGGGAGGTGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900706264 1:4082208-4082230 CTGGACGCAGGGTTGGCCGGGGG + Intergenic
901207800 1:7507378-7507400 CAGGCTGCAGGCTGGGGAGGGGG + Intronic
901210294 1:7520659-7520681 CTGGCTGCAGAGTTGGGCGGTGG + Intronic
901405352 1:9041396-9041418 CAGGCAGCAGCGTTGCTGGGAGG + Intronic
902863237 1:19260623-19260645 CAGGTGCCAGGCTTGGTCGGCGG + Intergenic
904573779 1:31488461-31488483 CTGGCTGTAGGGTGGCTCGGTGG + Intergenic
905034502 1:34908764-34908786 CAGGCTCCAGGGTGGGCCAGGGG - Intronic
905384885 1:37595733-37595755 CAGGCGGCAGGGCTGATCGAGGG - Intronic
905462674 1:38131821-38131843 CAGGATGCAGGGGTTGTAGGGGG + Intergenic
906214056 1:44029043-44029065 GAGGCTGCAGGTTTGGTGCGGGG + Intronic
912421919 1:109548460-109548482 CTGGCGGCTGGGTTGGGCGGCGG - Intergenic
912673074 1:111649363-111649385 CTGGCTGCAGGGATGGCCGAGGG - Intronic
915912329 1:159922882-159922904 CAGGCCCCAGCGTTGGGCGGTGG - Intronic
916168120 1:161981320-161981342 CAGGGTGCTGGGTTGGTTGCAGG + Intergenic
917711179 1:177687145-177687167 CAGGCTGCCGGCTTGTTCTGAGG + Intergenic
919727114 1:200891584-200891606 CAGGCCGCAGGGAGGCTCGGGGG + Intronic
924855910 1:247874828-247874850 CAGGCTTCTGTGTAGGTCGGGGG + Intronic
1062963552 10:1591272-1591294 CACACTGCAGGGCTGCTCGGAGG + Intronic
1064145950 10:12826617-12826639 CAGGCTGCAGGGCTGCTCCATGG - Intronic
1065190604 10:23204518-23204540 CAGGCTGCAGGAATGGTCTCAGG + Intronic
1067524109 10:47028072-47028094 CAGGCTGCTGGGATGCTGGGTGG - Intergenic
1067816484 10:49481602-49481624 CAGGCTGCAGCCTGGGTGGGAGG - Intronic
1069717631 10:70531160-70531182 CAGGTTGCAGGGATGGTGTGGGG + Intronic
1070670106 10:78371882-78371904 CAGGCCACAGTGTTGGTGGGAGG + Intergenic
1072806103 10:98424863-98424885 AAGGCTGCAGGATTGGCTGGAGG - Intronic
1074575274 10:114663055-114663077 CAGGCTGCAGTCTTTGTCAGCGG + Intronic
1074757465 10:116635112-116635134 CAGGCAGCAGGGTGGGCTGGAGG + Intronic
1075504275 10:123008663-123008685 CAGGCTGCCGGCTCGGACGGCGG - Intronic
1075570544 10:123538678-123538700 CAGGCAGCAGGATGGGGCGGTGG - Intergenic
1076452526 10:130566675-130566697 CAGGTGGCTGGGTTGGTTGGTGG - Intergenic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1077308604 11:1878676-1878698 CAGGCTGCAGGGTCAGGCAGCGG + Intronic
1077377413 11:2211542-2211564 CCGGCTCCAGGGTTGCTGGGAGG - Intergenic
1077842991 11:5994952-5994974 CTGGCTGCAGGGATGGCCGGGGG - Intergenic
1077868935 11:6245311-6245333 CAGGCTCCAGGGCTGGCCAGAGG - Intergenic
1078736713 11:14027022-14027044 CAGGCTGCAGGCTTTATCAGAGG - Intronic
1079785994 11:24673455-24673477 CAGGGTGCAGGGGTGGTCATGGG + Intronic
1083364144 11:62131214-62131236 CAGGCTGCAGGGTGGGTGAATGG - Intronic
1085274413 11:75289195-75289217 GAGGCTGCAGGGCTGGTCACGGG - Intronic
1085321928 11:75580230-75580252 AAGGCTGCAGGGTTGGAGTGGGG + Intergenic
1085646502 11:78226856-78226878 CAGGCTGCGGGGGAGGTCGTAGG + Exonic
1086912097 11:92484818-92484840 CAGGCTGCAGGGTTGTTAGATGG + Intronic
1088895763 11:114077216-114077238 CAGGCTGCAGGCTGGGGAGGGGG - Intronic
1088994905 11:114987735-114987757 CAGGATGCTGGGTGGGCCGGAGG - Intergenic
1089329244 11:117678275-117678297 CAGGCTACAGGGTGGGGTGGCGG + Intronic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1090392001 11:126394813-126394835 CAGGCTGCAGGGGCGGATGGTGG + Intronic
1090422848 11:126587488-126587510 CAGGCTACAGGGTTGGTGAGAGG - Intronic
1090650567 11:128802458-128802480 CAGGCTGCTGGGATGGACGTTGG + Intronic
1090836159 11:130455612-130455634 CAGGCTGCAGGGTTGGGAGAGGG + Intronic
1091305479 11:134533196-134533218 CAGGCTGCAGGGAGAGTGGGGGG + Intergenic
1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1091620931 12:2088419-2088441 CAGGCTGCTTGGTTTGCCGGAGG + Intronic
1091766412 12:3122970-3122992 GATGCTTCAGGGTTGGTCAGGGG + Intronic
1091790344 12:3268581-3268603 CAGGCTGCAGGAATGCACGGAGG - Intronic
1091790391 12:3268821-3268843 CAGGCTGCAGGAATGCACGGAGG - Intronic
1091790396 12:3268845-3268867 CAGGCTGCAGGAATGCACGGAGG - Intronic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1093264887 12:16991139-16991161 CTGGCTGTAGGGTTGCTCAGTGG - Intergenic
1095245856 12:39920414-39920436 CAGACTGAAGGGTTGGCTGGTGG + Intronic
1096652469 12:53068619-53068641 AAGGCTGCAGGGTTTTTCAGCGG - Intronic
1096713377 12:53475006-53475028 GAGGCTGGAGGGTGCGTCGGAGG - Intronic
1096773591 12:53951135-53951157 AGGGCTGCAGGGTTGGGCGGGGG + Intergenic
1098557978 12:71840326-71840348 CAAGCTGCTGAGTTGGTTGGTGG + Intronic
1101721281 12:107352724-107352746 CTGGCTGCTGGGTTTGTTGGAGG + Intronic
1103330065 12:120148112-120148134 AAGGCTGCGGCGTTGGTGGGAGG + Intronic
1103567680 12:121825031-121825053 CCGTCAGCAGGGTTGGTCAGCGG + Intronic
1103915778 12:124374903-124374925 GAGACTGGAGGGTTGGTGGGGGG - Intronic
1106410201 13:29506126-29506148 CAGGCTGGAGGGGTGGGCGCAGG - Intergenic
1111396271 13:87672548-87672570 CGGGCAGCAGGGTTGGGGGGTGG - Intergenic
1113046579 13:106162223-106162245 CAGGGTGCAGGGATTGTCCGTGG - Intergenic
1113968150 13:114166471-114166493 GAGGCTGCAGGCGGGGTCGGGGG - Intergenic
1114630328 14:24155384-24155406 CAGGATGCAGAGGTGGTGGGTGG - Intronic
1114664574 14:24370075-24370097 CAGGCTCCAGGGATCTTCGGGGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115770334 14:36659957-36659979 CAGTCTGCAGGGCTGCTAGGCGG - Intronic
1116487410 14:45467199-45467221 CTGGCTGCAGGGTTGGCCTTTGG + Intergenic
1117488493 14:56223103-56223125 CAGGCTGTAGAGGTGGACGGAGG - Intronic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118689356 14:68323232-68323254 CAGGCTGGACAGTTAGTCGGTGG + Intronic
1120996953 14:90424329-90424351 CAGGCTGCAGGGTTCGGGGGCGG - Intergenic
1122626932 14:103089661-103089683 AAGGCGGCCGTGTTGGTCGGCGG - Intergenic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1123032376 14:105458118-105458140 CAGGGTGCAAGGCTGGACGGAGG - Intronic
1123562752 15:21513235-21513257 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1123598996 15:21950518-21950540 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1125816126 15:42586290-42586312 CAGCCTGCAAGGTAGGTAGGAGG + Intronic
1129460329 15:75697209-75697231 CTGGCAGCAGGGATGGCCGGAGG - Intronic
1129461250 15:75701093-75701115 CAGTCTGCTGGGCTGGTCAGAGG - Intronic
1132449510 15:101958822-101958844 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
1202971103 15_KI270727v1_random:240368-240390 CAGGGGGCAGGGTGGGTTGGGGG - Intergenic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1134136065 16:11677145-11677167 CGGGGTGGAGGGTTGGTGGGGGG - Exonic
1135468925 16:22712107-22712129 AAGGCTGCAGGGTAGGTGGGGGG + Intergenic
1137636701 16:49993045-49993067 CAGGCCGCAGGGGAGGCCGGAGG + Intergenic
1138473716 16:57258384-57258406 CAGGCTGCTCGCTTGGTCTGAGG - Intronic
1140790496 16:78386626-78386648 CAGGCTGGGGGGTGGGGCGGGGG - Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1141660058 16:85436802-85436824 CAGGCTGCCGGGCTGGTGGTGGG + Intergenic
1141800028 16:86301192-86301214 CAGGCTGCAGGCATGGACGCTGG - Intergenic
1141873509 16:86805961-86805983 GAGGCTGCAGGGTTGGCCTATGG + Intergenic
1142120118 16:88383017-88383039 CTGGCTGCAGGGCTGGCCCGCGG + Intergenic
1142129274 16:88425379-88425401 CAGGCTGCAGGGTTGGGGGTAGG - Intergenic
1142198169 16:88748375-88748397 CAGGCTGCAGGCTTGGCACGTGG + Intronic
1142211473 16:88810602-88810624 CAGGGGCCAGGGTTGGCCGGTGG + Intronic
1142275069 16:89114153-89114175 CAGACTGCAGCGTTGGTCCCGGG + Intronic
1142295902 16:89222139-89222161 CAGGCAGCAGGGATGGTGGCTGG + Exonic
1143202430 17:5122125-5122147 CGGGGTGGAGGGTGGGTCGGTGG + Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144573612 17:16415823-16415845 CAGCCTGCGGGGTAAGTCGGTGG + Exonic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144829441 17:18123144-18123166 CAGGATGCCGGGGTGGTGGGCGG + Intronic
1145369126 17:22294248-22294270 CTGGCTACAGGGTGGGTGGGAGG - Intergenic
1146255501 17:31389782-31389804 CATTTTGCAGGGTAGGTCGGGGG + Intergenic
1147947571 17:44088650-44088672 CAAGATGCAGGGTCGGTGGGAGG - Intronic
1150934939 17:69625058-69625080 CAGGATGCTGGGTTGGGCAGCGG + Intergenic
1151448298 17:74181523-74181545 GAGGCTGCTGGGTTGGCTGGGGG + Intergenic
1152461988 17:80446338-80446360 GATGCTGCAGGGTTTGTCCGTGG - Intergenic
1152965734 18:112090-112112 CAGGCGGCGGGGTGGGGCGGTGG + Intergenic
1154300010 18:13184611-13184633 CACTCTGCAGGGATGGGCGGAGG - Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1160722865 19:604909-604931 AGGGCTGCAGGGTGGGGCGGGGG + Intronic
1160835633 19:1123255-1123277 CGGCCTGCTGGGTTGGTTGGGGG + Intronic
1160927448 19:1553720-1553742 CAGGCTGCAGGCTTGGGGAGTGG - Intergenic
1161591074 19:5129278-5129300 CTGGCTGCAGGGTCTGTTGGGGG + Intronic
1161745976 19:6060411-6060433 CAGATTGCAGGCTTGATCGGTGG - Intronic
1163715079 19:18868702-18868724 CACGCAGCAGGGCAGGTCGGCGG + Exonic
1164913860 19:32034074-32034096 CTGGCTGCAGGGTGGCTGGGAGG - Intergenic
1165055905 19:33176290-33176312 CATGCTGCAGGGATGCTGGGTGG + Intergenic
1165150456 19:33757069-33757091 CAGGGTGCTGGGCTGGGCGGAGG + Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1165792902 19:38502739-38502761 CAGGCTTCAGGGTGGGGCAGGGG + Intronic
1165810131 19:38607060-38607082 AAGGCTGGAGGGTGGGTCTGGGG + Intronic
1165991678 19:39818767-39818789 CAGGCAGCTGGGTTGGTCCTGGG - Intergenic
1166380073 19:42351120-42351142 CAGTCTGCAGGGTGGGGCAGGGG + Intronic
1167122779 19:47528871-47528893 AGAGCTGCAGGGCTGGTCGGGGG - Intronic
1167145560 19:47679557-47679579 CAGGCTGCAGGGTGGGCAGCTGG - Exonic
925768620 2:7261195-7261217 CAGGCTGTAGAGTTAGTGGGAGG + Intergenic
926002771 2:9347104-9347126 CATCCTGCAGGGGTGGTAGGTGG + Intronic
926144178 2:10386763-10386785 CAGGCAGCGGGGCTGGTGGGGGG - Intronic
927683432 2:25154959-25154981 CAGGATGCAGGGCTGGCAGGAGG + Exonic
930235426 2:48884592-48884614 GAAGCTGCAGGTGTGGTCGGGGG - Intergenic
930261665 2:49154102-49154124 CAGGCAGGAGGGTTGGGCTGGGG + Intronic
931470183 2:62531735-62531757 CATTCTGCAGGGGTGGTCTGTGG + Intergenic
931709927 2:64979882-64979904 CAGGCTGACTGGTTGGTCGTTGG + Intergenic
932461281 2:71883453-71883475 CAGACTGCAGGTTTGGCCTGTGG + Intergenic
934521825 2:95024749-95024771 CAGGCTTCAGTGTTTGTAGGAGG + Intergenic
935833633 2:107026046-107026068 CAAGCTTCAGGGTGGGTGGGTGG - Intergenic
936565730 2:113581322-113581344 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
937424698 2:121789371-121789393 CAGCCTGCAGGGTGGGTAGGGGG + Intergenic
937714364 2:125014652-125014674 CAGGTAGCAGGGTTGGGGGGTGG - Intergenic
937915015 2:127094756-127094778 TGGGCTGCAGGGCTGGGCGGGGG - Intronic
937924043 2:127154120-127154142 TAGGGTGCAGGGATGGGCGGGGG - Intergenic
938228353 2:129636847-129636869 TAAGCTGCAGGGTGGGTTGGGGG - Intergenic
939200876 2:139031954-139031976 CAGGTTGCATGGTGGGTAGGTGG + Intergenic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
948903743 2:240968269-240968291 CAGGCGGCAGGGTGGGTCCCAGG + Intronic
1168803858 20:661823-661845 GAGGCTGCAGGGATGGTGGGAGG - Exonic
1168827516 20:823546-823568 CAGGCTGCAGTGTTGGGGAGGGG + Intergenic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1168831641 20:848352-848374 AAGGCTGCAGGGTTGGGGGAGGG - Intronic
1168971157 20:1931723-1931745 CAGGTTGCAGGGCTGGTGGAGGG + Intronic
1169054870 20:2612274-2612296 CAGGGTGCAGGGGTGGTCGGGGG - Exonic
1169449228 20:5697107-5697129 CACGCTGCAGTTTTGGTGGGTGG - Intergenic
1170621451 20:17999806-17999828 CAGGCTGCAGAAGTGGGCGGGGG + Intronic
1171204288 20:23266972-23266994 CAGGAGGCAGGGTGGGTGGGAGG + Intergenic
1173229465 20:41182925-41182947 CTGGCTGAAGAGTTGGTCTGTGG - Exonic
1173684328 20:44911950-44911972 CAGGCTGCAGCAGTGGCCGGAGG + Intronic
1174358701 20:50014996-50015018 CATGCAGCAGGGTTGGTGGGCGG + Intergenic
1174386239 20:50190114-50190136 CAGGCGGCAGGTGTGGTGGGCGG + Intergenic
1174449207 20:50609410-50609432 CTGGCTGCAGGGATGGTTAGAGG - Intronic
1176085314 20:63293123-63293145 CAGGCCGAGGGGTGGGTCGGGGG + Intergenic
1178902049 21:36606025-36606047 CAGGGTGGAGGGTTGGGCTGTGG - Intergenic
1179072356 21:38083492-38083514 CAGGCTGCTTGGCTGGTGGGGGG - Intronic
1180869997 22:19140601-19140623 ATGGTGGCAGGGTTGGTCGGAGG - Intronic
1180885584 22:19241025-19241047 CCGGCTGCAGGGTGGGTGTGGGG - Intronic
1180959928 22:19757936-19757958 CAGGCGGCAGGGGTTGTGGGGGG + Intronic
1182023663 22:27101023-27101045 CAGGCTGCAGGGGCGGGGGGAGG + Intergenic
1183485334 22:38085150-38085172 CAGGCTGCCGGGGTGGTCTGGGG + Exonic
1184390441 22:44200532-44200554 CAGGCTGGAGTGTTGGTGGCTGG + Intronic
1184489792 22:44801946-44801968 CAGGCAGCAGCGTTCCTCGGAGG - Intronic
1184607381 22:45581883-45581905 CAGGGTGCAGGGAGGGTCGAGGG + Intronic
949268824 3:2190608-2190630 CAGTCTGCATGGGTGGTAGGTGG + Intronic
949889657 3:8724341-8724363 CATGCTGTAGGGTTGGTGTGGGG - Intronic
950518663 3:13483371-13483393 CAGGCTGCAGACTTGGCCTGTGG - Intronic
952708599 3:36406149-36406171 CAGGCTGCTGGGTGGGGAGGGGG - Intronic
956082341 3:65570846-65570868 CAGGCTGCCTGGTTGTTTGGGGG + Intronic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
958561905 3:95758770-95758792 AAGCCTGCAGGGTGGGTGGGAGG - Intergenic
961018063 3:123482466-123482488 CAGGCTGTAGGGTGGGGTGGGGG + Intergenic
962315201 3:134354911-134354933 CAGGCTGGAGGGTTGGGTGGAGG + Intergenic
962358285 3:134713641-134713663 CTGGGTGCAGGCTTGGTCTGGGG + Intronic
963089701 3:141471691-141471713 CTGGCTGCGGGGATGGCCGGGGG - Intergenic
966941489 3:184750674-184750696 CAGGCTGCATGGAGGGTGGGTGG + Intergenic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
970104532 4:12566297-12566319 CTGACTGCATGGTTGGTCTGTGG - Intergenic
970405190 4:15756191-15756213 AAGACTGCAGGGTGGGTTGGGGG + Intergenic
971420584 4:26470557-26470579 AATGCTGCAGTGTTGGTAGGTGG - Intergenic
972538667 4:40020426-40020448 CTGGCTGCTGGGATGGCCGGGGG + Intergenic
974357296 4:60829427-60829449 CTGGCTGCAGGTTTGGTGGGAGG + Intergenic
983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG + Intronic
985504627 5:271888-271910 CAGGGAACGGGGTTGGTCGGGGG - Intronic
985645972 5:1084950-1084972 CAGGTTTCAGGGGTGGCCGGTGG - Intronic
988066362 5:26231568-26231590 CAGGCTCTGGGGTTGGTGGGTGG + Intergenic
989207493 5:38825850-38825872 CAGGGTTCAAGGTTGGTGGGAGG + Intergenic
990179932 5:53149422-53149444 AAAGCTGCAGGGTTGGCTGGTGG - Intergenic
990347552 5:54884486-54884508 CAGGCTGGAGGGTTGGGAGGAGG + Intergenic
991909688 5:71549270-71549292 CAGGCTGGGGGGTTGTTGGGGGG + Intronic
996357676 5:122615003-122615025 CAGGCTGTGGGGGTGGTGGGGGG - Intergenic
996753807 5:126915607-126915629 GTGGCTGCAGGGTTGGTTGCTGG - Intronic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
999928231 5:156403126-156403148 AAGGCGGCAGGGTGGGTTGGAGG - Intronic
1001250271 5:170141736-170141758 CTGGCTGCGGGGCTGGCCGGGGG - Intergenic
1001965943 5:175910101-175910123 CAAGCTGCAGGGGAGGTGGGGGG - Intergenic
1002251002 5:177929099-177929121 CAAGCTGCAGGGGAGGTGGGGGG + Intergenic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1005727467 6:28663854-28663876 CATTCTGCAGGCTTGGTGGGAGG + Intergenic
1006984974 6:38169998-38170020 CAGGGTGCTGGGTGGGTTGGAGG + Exonic
1006987234 6:38184091-38184113 CAGGCTGCAGGGACTGTGGGTGG - Intronic
1007264247 6:40585386-40585408 CAGGCAGCTGGCATGGTCGGCGG + Intronic
1011543809 6:88463175-88463197 CAGTCGGCAGGGTTGGTCAGGGG + Intergenic
1013585588 6:111575681-111575703 CTGGCTGGAGGGTTGCTAGGGGG + Exonic
1013667387 6:112362518-112362540 CTGGCTGCCGGGATGGCCGGGGG - Intergenic
1014009300 6:116458397-116458419 CTGGCTGCAGGGATGGCCAGGGG - Intergenic
1016045422 6:139475901-139475923 CATGGTGCAGGGTTGGTAGGGGG + Intergenic
1018809284 6:167285721-167285743 CAGCCTGGAGGGTAGGTGGGGGG + Intronic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019186701 6:170224699-170224721 CAGGAGGCAGGGGTGGTCAGTGG - Intergenic
1019928553 7:4208738-4208760 CAGTCTCCAGGGGTGGTCTGTGG - Intronic
1020276040 7:6625196-6625218 CAGGCTGGAAGGCTGGTCTGGGG - Intergenic
1020970498 7:14931832-14931854 CAGGGAGCGGGGTGGGTCGGGGG + Intronic
1021025197 7:15658237-15658259 CAGCCTGCAGGGGAGGTGGGAGG + Intronic
1022501637 7:30885708-30885730 AAGGCAGCAGGGTTGGGGGGGGG - Intronic
1022806154 7:33824496-33824518 TAGGCTGCAGGGTAGGTGGCAGG - Intergenic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1023905929 7:44521589-44521611 CATCCTGCAGGGTCTGTCGGGGG - Intronic
1024222528 7:47299669-47299691 CAGGCTGCAGGGGTGCAAGGGGG + Intronic
1024297211 7:47854344-47854366 CAGTCTGCAGAGTTCGTTGGAGG - Intronic
1024298090 7:47862386-47862408 CAGGCAGGAGGGATGGTAGGAGG + Intronic
1024942809 7:54779947-54779969 CAGGCTGCTGGGTTGATGGCTGG - Intergenic
1024986930 7:55202336-55202358 CAGGCTGCAGGGTGGGCAGCAGG - Intronic
1027163475 7:75818696-75818718 GAGGCTGGAGGGTGGGTGGGAGG + Intronic
1029124797 7:98288372-98288394 CAGTCGGCAGGGCTGGGCGGAGG + Intronic
1034099546 7:148439094-148439116 CATCCTGCAGGCTTGGTAGGAGG - Intergenic
1034457939 7:151181542-151181564 CAGGATGGAGGGTGGGTGGGGGG - Intronic
1036645756 8:10610879-10610901 CAGGCTGCAGGGTGAGCCTGCGG - Exonic
1036691594 8:10948005-10948027 CAGGGTGCAGGGTGGGTTAGGGG + Intronic
1038055491 8:23853843-23853865 CAGGCAGCAGGGTTGGGGGTGGG + Intronic
1038342824 8:26702019-26702041 CAGTCTGCTGGGTAGGTCTGTGG + Intergenic
1038867298 8:31453697-31453719 CGGGGTGAAGGGTTGGTTGGTGG + Intergenic
1043482011 8:80663500-80663522 CAGAATGCAGGGTTGGTGGGGGG + Intronic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1049372625 8:142274979-142275001 GAGGCTGCAGGGATGGGCGCTGG + Intronic
1049584819 8:143428034-143428056 CAGCCTGGCTGGTTGGTCGGTGG - Intronic
1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1050437615 9:5627468-5627490 CAGGCTGCTGTGTTGGACTGGGG + Intergenic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1053067342 9:35078029-35078051 CAGGCGGCTGGGTTGGTGGTCGG - Intronic
1056616431 9:88171147-88171169 CTAGCTTCAGGGTTGGTCAGTGG - Intergenic
1057314091 9:93958095-93958117 CATGCTGCAGGGCTGGCCTGGGG - Intergenic
1057483050 9:95460813-95460835 CAGGCAGCAGGGCTGGGCGAGGG - Intronic
1057648219 9:96896979-96897001 CAGGTTGCAGGGTAGCTAGGTGG - Intergenic
1059431661 9:114254244-114254266 GAGGAAGCAGGGTTGGTGGGAGG + Intronic
1060918899 9:127406762-127406784 GAGGGTGGAGGGTTGGTCTGTGG + Intronic
1061165856 9:128921897-128921919 TGGGATGCAGGGTTGGTCTGGGG - Intronic
1061374389 9:130215462-130215484 CAGGCTGCAGGGATTCTGGGTGG + Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062433389 9:136535655-136535677 ATGGGTGCAGGGTGGGTCGGGGG + Intronic
1062507888 9:136887139-136887161 CTGGCTGCTGGGAGGGTCGGGGG + Intronic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1188003468 X:25002499-25002521 GAGGGTGCAGGGTTGGGCAGAGG - Intergenic
1188098459 X:26051726-26051748 CTAGCTGCAGGGGTGGTCAGAGG - Intergenic
1189302198 X:39960167-39960189 CAGGCAGCAGGGATGGAGGGCGG - Intergenic
1193820737 X:86161162-86161184 CTGGCTGCAGGGTGGCTCAGTGG + Intronic
1193986033 X:88241510-88241532 GAGGGTGCAGGGTTGGACGAGGG + Intergenic
1195547122 X:106125166-106125188 CACACTCCAGGGCTGGTCGGCGG - Intergenic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1197996875 X:132386799-132386821 CAGGCTGCAGGGCCTGTGGGGGG + Exonic
1198603486 X:138310848-138310870 AAGACTGCAGGGTGGGTTGGAGG + Intergenic
1199866149 X:151851970-151851992 CAGACTGCTTGCTTGGTCGGTGG - Intergenic
1200116840 X:153773211-153773233 CAGGCTGCAGGATGGGTAGTGGG - Exonic
1200216773 X:154371533-154371555 CGGGCTCCAGGGTGGGTCGCTGG + Intronic