ID: 997264864

View in Genome Browser
Species Human (GRCh38)
Location 5:132489698-132489720
Sequence TCCTCCAGAGACTGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997264864_997264870 4 Left 997264864 5:132489698-132489720 CCTCCCAGCCAGTCTCTGGAGGA 0: 1
1: 0
2: 1
3: 28
4: 259
Right 997264870 5:132489725-132489747 GGCATGCAAGTGATGGCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 122
997264864_997264871 17 Left 997264864 5:132489698-132489720 CCTCCCAGCCAGTCTCTGGAGGA 0: 1
1: 0
2: 1
3: 28
4: 259
Right 997264871 5:132489738-132489760 TGGCTTCAGGATTCATATGCAGG No data
997264864_997264869 -3 Left 997264864 5:132489698-132489720 CCTCCCAGCCAGTCTCTGGAGGA 0: 1
1: 0
2: 1
3: 28
4: 259
Right 997264869 5:132489718-132489740 GGAGACAGGCATGCAAGTGATGG 0: 1
1: 0
2: 1
3: 32
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997264864 Original CRISPR TCCTCCAGAGACTGGCTGGG AGG (reversed) Intronic
900491002 1:2949110-2949132 TCCAGCAGAGCCTGCCTGGGAGG - Intergenic
900979240 1:6036920-6036942 TGCAACAGAGACTGGCTGGCTGG - Intronic
901058369 1:6460203-6460225 TCCACCAGGGCCTGGCTGGCTGG - Exonic
901215418 1:7552203-7552225 GCCTCCAGAGCTAGGCTGGGTGG - Intronic
901218157 1:7566283-7566305 TCCTCCAGAGACAGGGTCGATGG - Intronic
901292312 1:8133491-8133513 TCCTCCTGAGACTGGGTGCCAGG + Intergenic
902803771 1:18848200-18848222 TCCACCACAGACTAGCTGTGTGG + Intronic
902926576 1:19700039-19700061 TCATCCAGAGGCTGGATGGATGG + Intronic
903595228 1:24489038-24489060 TCCTCTTGAGACTGGCTGATCGG - Intergenic
904360916 1:29971260-29971282 GGCTCCAGAGACTGGCTGGAGGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906314182 1:44775744-44775766 GCCCCCAGAGACGGGCTGGGCGG - Intronic
906655741 1:47547209-47547231 TTGTCCTGAGTCTGGCTGGGAGG + Intergenic
907558477 1:55366603-55366625 TCCTTCAGAGACTGGCCTGAAGG - Intergenic
913488436 1:119355650-119355672 TCCTCCAGTGACTGCCTTGCTGG + Intergenic
914332314 1:146683590-146683612 TCTACCAGAGACTTGCTGGCTGG - Intergenic
915558391 1:156672925-156672947 TGCTCCAGACACAGGGTGGGAGG - Exonic
915596931 1:156901351-156901373 TCCTCTAGAAGTTGGCTGGGAGG + Intronic
915937538 1:160098234-160098256 TCTTCCCAAGACTGGCTCGGCGG + Intronic
916645910 1:166784956-166784978 TCCTCCTGTGCCTGGCTTGGTGG - Intergenic
917751577 1:178058209-178058231 TCCTTCAGTCACTAGCTGGGGGG - Intergenic
920409616 1:205749490-205749512 TCCCCCAGCGACTGGCGCGGGGG - Intronic
920655253 1:207869388-207869410 CCCTTCAGAGACAGGGTGGGTGG - Intergenic
921332478 1:214053231-214053253 TCCTCCAGGGCCTGGCGCGGTGG - Intergenic
921957296 1:220998020-220998042 CTCTCCAGAGGCAGGCTGGGAGG - Intergenic
922912634 1:229230368-229230390 GCCTCCAGAAACCGGCGGGGAGG + Intergenic
923474744 1:234321819-234321841 TGCTCAAGGGACTGGCTGGTTGG + Intronic
924813993 1:247426821-247426843 TCCTCCGGAAGCTGGCTGAGCGG - Intronic
1063120966 10:3105453-3105475 TCCACCAGAGGAAGGCTGGGAGG + Exonic
1063501647 10:6560452-6560474 TTCTGCAAACACTGGCTGGGAGG + Intronic
1067102445 10:43342942-43342964 TCCACCAGAGACTGGGTACGTGG + Intergenic
1067170540 10:43902702-43902724 TTCTCCAAATACAGGCTGGGTGG - Intergenic
1069855566 10:71439173-71439195 GCCTCCACAGACTTGCTGTGAGG + Intronic
1070370659 10:75779007-75779029 TATTCCAGAGGCTAGCTGGGAGG - Intronic
1071393547 10:85199325-85199347 TCCACCACTGACTGGCTGAGTGG + Intergenic
1071490288 10:86131554-86131576 CCTTACAGAGACTGTCTGGGAGG - Intronic
1076270134 10:129145125-129145147 TCCACCTGTGAATGGCTGGGTGG + Intergenic
1076788864 10:132765897-132765919 TGCACCAGAGACTGGGAGGGTGG - Intronic
1076815656 10:132913596-132913618 TTTTCCACGGACTGGCTGGGTGG - Intronic
1077077778 11:709084-709106 CCCCCCAGAGGCTGACTGGGAGG - Intronic
1078407757 11:11086172-11086194 TGCTTCAGAGCCTGGCTGGAGGG + Intergenic
1078450808 11:11439318-11439340 TCCTCCAGAGCCTGCCTGTGTGG + Intronic
1079242356 11:18729629-18729651 CGCTCCAGTGGCTGGCTGGGAGG + Intronic
1079767684 11:24415904-24415926 TACTCCTGAGTCTGGCGGGGAGG - Intergenic
1079807642 11:24954479-24954501 TCATCCAGAGACTGGGAGTGTGG + Intronic
1080912193 11:36613595-36613617 CCCTCCAAACACAGGCTGGGTGG - Intronic
1081669189 11:44933789-44933811 GCCTCCAGGGTCTGGCTGAGTGG - Exonic
1081781232 11:45714460-45714482 TATGCCAGAGAGTGGCTGGGAGG - Intergenic
1082127847 11:48453759-48453781 CCCTCCAGTGCCTGGCTTGGTGG - Intergenic
1084459602 11:69289142-69289164 TCCTCCAGAGCCTTGCAGAGGGG - Intergenic
1085200911 11:74701580-74701602 TCCTCCACTTACTGGCTGTGTGG + Exonic
1088731665 11:112689184-112689206 TCCCCCAAACACTGGCTGGCAGG - Intergenic
1088747541 11:112817068-112817090 TCCTCCAGATCCTGGCTGAATGG - Intergenic
1089283577 11:117391457-117391479 TCCTCCAGGGTCAGGCTGGATGG + Intronic
1089949658 11:122513538-122513560 TCCTTCATAGAGTGGCTGGGTGG + Intergenic
1090908343 11:131096701-131096723 TCTTCGGGAGACTGGCTGGTGGG + Intergenic
1091270799 11:134310525-134310547 TCCTGCAGAGACTGCATGGCTGG + Intronic
1092492143 12:8955497-8955519 TACTCCACAGGCTAGCTGGGAGG - Intronic
1092928233 12:13291473-13291495 GTCTGCAGGGACTGGCTGGGAGG - Intergenic
1093059663 12:14589424-14589446 GCCTGCAGAGACAGGGTGGGGGG + Intergenic
1096988187 12:55776028-55776050 TCCTTCAGAGTCTGTATGGGAGG - Intronic
1096997180 12:55845953-55845975 GCCCCTAGAGACTGTCTGGGAGG + Intergenic
1097457476 12:59817494-59817516 TACTCTAGAGGCTGGGTGGGAGG - Intergenic
1098092733 12:66921418-66921440 TGCTCAAGAGTCTGGCTAGGAGG - Intergenic
1098382606 12:69884511-69884533 TTCTCCAGACACTGACAGGGAGG - Intronic
1100676777 12:96877281-96877303 ACCTGCAGAGTCTGGCGGGGAGG + Intergenic
1102241640 12:111328220-111328242 TCCCACAGAGTCTGGCTGTGGGG + Intronic
1102395567 12:112582979-112583001 TGCCCCAGAAACTTGCTGGGTGG + Intronic
1103504594 12:121433327-121433349 TCCTCCACAGGCTGGCGGGCGGG - Intronic
1103535263 12:121629600-121629622 TCCCCAAGAGACAGACTGGGTGG - Intronic
1103544371 12:121689370-121689392 TCATTCTGAGACTGGGTGGGTGG + Intergenic
1104056297 12:125233416-125233438 TCCTCCAGGGCCTGCCTGGAAGG - Intronic
1105821626 13:24085737-24085759 TCCCACAGAGGCTGGCTGAGTGG - Intronic
1106129792 13:26930808-26930830 TCCTACATAGACTGGCAAGGCGG + Intergenic
1110570297 13:76995592-76995614 GCTTCCAGAGACTGGCATGGGGG + Intronic
1111683672 13:91475621-91475643 TGCTCCAGGGCCTGGCTGGTGGG + Intronic
1113375567 13:109762403-109762425 TCTTCCACAGACTGGCAGGGAGG - Intronic
1113445228 13:110360938-110360960 CACTCCAGTGACTGGCTGTGTGG - Intronic
1113933726 13:113982198-113982220 TCCTCCTGGTTCTGGCTGGGCGG - Intronic
1114413394 14:22521082-22521104 TCAGCCATAGACTGGCTGTGGGG - Intergenic
1118287315 14:64487647-64487669 TCCTCCAGGGCCTGGGTGGCAGG + Exonic
1119358879 14:74031220-74031242 TACTCCGGAGGCTGGGTGGGAGG - Intronic
1119653049 14:76397219-76397241 ACCTCCAGAGGCTGCCTGTGGGG + Intronic
1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG + Intergenic
1124400372 15:29342559-29342581 TCCTCCTGGGGCTGGTTGGGGGG + Intronic
1126687202 15:51258681-51258703 TCTTCCAGAGACTGGCGCAGGGG - Intronic
1127257745 15:57306396-57306418 CCCTCCAGAGACAGCCTGGGGGG - Intergenic
1128258840 15:66217759-66217781 TCTGCCAGGGACTGGCTGTGTGG - Intronic
1130143709 15:81255420-81255442 TACTTCAGAGACTGGCTGCATGG + Intronic
1131157479 15:90084165-90084187 GCCTCCAGAGAGGGGCTGTGAGG + Exonic
1132681485 16:1144271-1144293 TCCTCCAGGGCCTGGATGAGAGG + Intergenic
1132851342 16:2026405-2026427 TCTCCCAGCCACTGGCTGGGAGG + Intronic
1133133774 16:3694922-3694944 TCCTCCTGAGGCTGGGAGGGAGG + Intronic
1133583356 16:7167521-7167543 CCCTCCAAAGACTGCATGGGAGG - Intronic
1133649051 16:7792407-7792429 GCCACCAGTGACTGGCTGAGTGG - Intergenic
1134133959 16:11667959-11667981 TCCGCCATCGACTGACTGGGCGG + Intergenic
1136401909 16:30023913-30023935 TCCTCCAGACCCTGGCGGGGAGG - Intronic
1140001239 16:71027329-71027351 TCTACCAGAGACTTGCTGGCTGG + Intronic
1141515229 16:84539698-84539720 TCCTCCCGAGTCTCCCTGGGGGG - Intronic
1141895163 16:86954418-86954440 TCCTGCGGGGACTGGATGGGTGG + Intergenic
1141896526 16:86962193-86962215 TTCTCCAGGGACAGGCCGGGAGG - Intergenic
1142305376 16:89281497-89281519 GACTCCAAAGACTGGCTGGCAGG - Exonic
1142307555 16:89294056-89294078 GCCCCCAGAGACTTCCTGGGTGG + Intronic
1142664937 17:1457170-1457192 TACTCCATAGACTGGCTGTGGGG - Intronic
1142687631 17:1586881-1586903 TTGAACAGAGACTGGCTGGGAGG + Intronic
1143541447 17:7572021-7572043 GTCTCAAGAGACTGGCTGGAAGG - Intronic
1144500984 17:15786567-15786589 CCCTCCAGAGCCTGGCCGCGGGG - Intergenic
1145163150 17:20589242-20589264 CCCTCCAGAGCCTGGCCGGGGGG - Intergenic
1146608740 17:34286029-34286051 TCTTCCAGTGACTGGATGTGAGG - Intronic
1147620581 17:41864168-41864190 TGCTCCAGAGACTGGTTAGAAGG - Intronic
1148853784 17:50567574-50567596 CCCTACAGAGTCTGGCTTGGTGG + Intronic
1152316174 17:79581693-79581715 TCCTCCAGCCCCTGGCTGTGTGG - Intergenic
1153973903 18:10249884-10249906 TCTTCCAGTGACTGGCTCAGGGG + Intergenic
1156366911 18:36438027-36438049 TCCTCCAGAGGCTGCCTGCAGGG + Intronic
1159533136 18:69680792-69680814 TACTCCAAGGACTGGGTGGGAGG - Intronic
1160343127 18:78107056-78107078 TCTTCCAGAGACAGGCTCCGCGG + Intergenic
1160517877 18:79488471-79488493 ACCTCCAGAGAGTGGCCAGGGGG - Intronic
1160869424 19:1270233-1270255 GCCTCCTGAGACTGGGGGGGGGG - Intronic
1161010302 19:1956636-1956658 CCCTCCACAGAGGGGCTGGGTGG + Intronic
1161420444 19:4173631-4173653 CCCTCCAGAGGCGGGGTGGGGGG + Intergenic
1161644655 19:5445658-5445680 CCCTCCTGGGCCTGGCTGGGAGG + Intergenic
1162065732 19:8124148-8124170 TCCTCCAGGCACTGTCTGGGAGG + Intronic
1162123212 19:8485131-8485153 TCCTAGAGGGACAGGCTGGGAGG + Intronic
1162419970 19:10560522-10560544 TACTCCAGAGGCTGGCTGTGAGG - Intronic
1162461221 19:10815565-10815587 TCCTACAGAGAGGAGCTGGGAGG - Intronic
1163936810 19:20453792-20453814 TCTCCCAGACAGTGGCTGGGAGG + Intergenic
1165247313 19:34505015-34505037 GCCTCCAGAGCTGGGCTGGGTGG - Exonic
1165742375 19:38211646-38211668 TCCTCCAAGGCCTGGCTGGGTGG - Intronic
1165943076 19:39424990-39425012 TCAGCCAGAGCCTGGCTCGGCGG + Exonic
1167103754 19:47419110-47419132 CCCTCCAGAGCCTGGCCGCGGGG + Exonic
1167116458 19:47491882-47491904 TCATCCAAAGGCTGGCTGGCAGG + Intronic
1167148206 19:47694916-47694938 TCCTCCAGAACAAGGCTGGGGGG + Exonic
925389981 2:3488012-3488034 TCCACCAGAGCCTGTCTGTGAGG - Intergenic
925457788 2:4031045-4031067 TTCTCCAGAGACTGGGGAGGAGG + Intergenic
925990259 2:9249120-9249142 TCCACCACAGACTGGCTGTGTGG - Intronic
927149553 2:20187802-20187824 TCCTCTAGTGGCTGGCGGGGAGG - Intergenic
927460096 2:23291525-23291547 CCTTCCAAAGACTGGCTGTGGGG - Intergenic
927857333 2:26535815-26535837 TCCCCCTGAGGCAGGCTGGGCGG + Intronic
929623439 2:43381387-43381409 ACCTCCTGAGGCTGGGTGGGGGG - Intronic
931621657 2:64216667-64216689 TCCTCCAGTGCCTGGTTGTGTGG + Intergenic
932167205 2:69519162-69519184 TGCGGCAGAGGCTGGCTGGGTGG + Exonic
932413753 2:71561744-71561766 TCACCCAGAGGCTGGCTGTGAGG - Exonic
932465997 2:71924686-71924708 TCCTCCACTTGCTGGCTGGGTGG + Intergenic
932624084 2:73284341-73284363 TCCCGCTGCGACTGGCTGGGAGG - Exonic
933275984 2:80284904-80284926 TGCTCCACAGTCTAGCTGGGGGG - Intronic
935205495 2:100893265-100893287 CTCACCAGGGACTGGCTGGGAGG + Intronic
935844282 2:107147785-107147807 TGCTCCTTAGACTGGCTTGGAGG - Intergenic
936434683 2:112494046-112494068 TCCCCCAGAGACTTTCCGGGAGG - Intronic
937912127 2:127080897-127080919 TCCTCCCTAGAAAGGCTGGGTGG + Intronic
940375100 2:152948833-152948855 TTTTCCATAGACTGGCTGGTGGG + Intergenic
942452449 2:176116651-176116673 TGCTCCAGAGCCTGGCCGGCCGG - Exonic
944580694 2:201130160-201130182 TCTTCCTGAGGCTGGGTGGGTGG + Intronic
945990516 2:216392087-216392109 ACATCCAGAGAATGGCAGGGTGG + Intergenic
946368579 2:219266442-219266464 TCCTCCTTATACTCGCTGGGTGG - Intronic
946598969 2:221338556-221338578 TCCCCCAGAGACCAGCTGGGAGG - Intergenic
948430002 2:237912887-237912909 GCCTCTTGGGACTGGCTGGGTGG - Intergenic
949042356 2:241855188-241855210 GCCTCCACCAACTGGCTGGGTGG + Intronic
1169209993 20:3760479-3760501 ACCCCCAGAGACTGGCAGGAGGG + Intronic
1170436113 20:16330984-16331006 TGCTCCAGAGACTGCTTGGGGGG + Intronic
1171243201 20:23587810-23587832 TCCTCCATAGATGTGCTGGGAGG + Intergenic
1172034612 20:32002216-32002238 TCCTCCAGAGAAGGGAAGGGTGG - Exonic
1172938436 20:38637835-38637857 TCCTTCAGAGGCTGGCTCAGGGG + Intronic
1173662280 20:44742935-44742957 TCAGCCACAGCCTGGCTGGGAGG + Intergenic
1174668785 20:52285930-52285952 TTCTCCAGTGACTGGCTTGGAGG - Intergenic
1175050268 20:56149025-56149047 TCCAGCAGAGACTGGCATGGAGG - Intergenic
1175998722 20:62822506-62822528 TCCGTCAGAGAGTGGGTGGGTGG + Intronic
1178250595 21:31000006-31000028 TCCTCCAGAGCCAGGCAGGTGGG + Intergenic
1178627849 21:34233207-34233229 TCCTCCTGAGGCTGGGAGGGAGG + Intergenic
1179138931 21:38705688-38705710 TTCTCCAGGGACTGCCAGGGAGG - Intergenic
1181907830 22:26213313-26213335 GGCTCCAGACACCGGCTGGGTGG + Intronic
1182008796 22:26983313-26983335 ATCTCCAGAGGGTGGCTGGGAGG - Intergenic
1183234959 22:36610177-36610199 TCCCCCAGAGAGTGACTGGGAGG + Intronic
1184147028 22:42617749-42617771 TGCTCCGGAGACTTGCTGGGTGG - Intergenic
1184724426 22:46335412-46335434 GCCTCCAATGGCTGGCTGGGGGG + Exonic
1184767657 22:46579962-46579984 GACACCAGGGACTGGCTGGGTGG + Intronic
950028808 3:9838380-9838402 TGCAGCAGAGACTGGCTAGGGGG + Intronic
950424080 3:12915232-12915254 TACCCCACATACTGGCTGGGTGG - Intronic
950743669 3:15069578-15069600 TCCACCACTGACTGGCTGTGTGG + Intergenic
950822492 3:15775909-15775931 TTCTCCAGAGACTGGGGGGTGGG + Intronic
951199492 3:19861502-19861524 TCCTCCAGAGAGTGGATTAGGGG + Intergenic
951231630 3:20186224-20186246 TCCTCCATTGGTTGGCTGGGAGG + Intronic
952145711 3:30529852-30529874 TCTTCCAAACATTGGCTGGGTGG + Intergenic
959527851 3:107397687-107397709 TCCCCGAGAGGCTGGCTGGAGGG - Intergenic
961385546 3:126521523-126521545 TCCCACAGAGCCTGGCTGTGTGG - Intergenic
961590207 3:127973929-127973951 TTCTCCAGGGTGTGGCTGGGGGG - Intronic
961614116 3:128165138-128165160 TCCCTAGGAGACTGGCTGGGAGG - Intronic
961648228 3:128404060-128404082 ACCCGCAGAGTCTGGCTGGGTGG + Intronic
962372287 3:134830782-134830804 CCCACCAGACACTAGCTGGGAGG - Intronic
967977051 3:195041303-195041325 TCCTCCAGAGAATGGGGGCGGGG - Intergenic
968504588 4:965966-965988 TCCTCGGGAGACAGGCCGGGAGG + Exonic
968732048 4:2273819-2273841 TCCTCCAGGGAGTGGCGGCGGGG - Intronic
968956603 4:3722685-3722707 TCCTTCTGGGTCTGGCTGGGTGG + Intergenic
970155565 4:13138193-13138215 TCCTCTAGGAACTGGCTGTGTGG + Intergenic
970779690 4:19721590-19721612 CACTCCAGAGGCTGGCTGGAAGG + Intergenic
971395334 4:26221917-26221939 CAATCCAGAGACTGGCAGGGCGG + Intronic
972251787 4:37309580-37309602 GGTTCCAGAGAATGGCTGGGGGG + Intronic
972741393 4:41890106-41890128 TCATCCAGAGCCTGGCTTGCTGG + Intergenic
973840999 4:54860493-54860515 CCACCCAGAGACTGACTGGGTGG - Intergenic
974157503 4:58093156-58093178 TTCTCCACAGACTGGCATGGGGG + Intergenic
975028604 4:69584304-69584326 ATCTCTTGAGACTGGCTGGGAGG + Intergenic
975437181 4:74366024-74366046 TGCTCCAGAGGCTGCTTGGGAGG - Intronic
980477319 4:133334294-133334316 CCCTCCAGTGCCTGGCTCGGTGG - Intergenic
980526603 4:133996664-133996686 TCCTGCAGACTCTGGCTGAGGGG + Intergenic
984714473 4:182913833-182913855 TCCTTCAGAGATTGCCTGGGAGG - Intronic
986227268 5:5827422-5827444 TCCTTCAGAGCCTGGCTGCAAGG - Intergenic
986877167 5:12125976-12125998 CCCTCCCGTGTCTGGCTGGGTGG + Intergenic
987920571 5:24274861-24274883 TCCTGCAGAGACTGGGAAGGGGG + Intergenic
993770544 5:91919275-91919297 TTTTCCACAGACTGGGTGGGGGG + Intergenic
995397044 5:111698101-111698123 TCTTCCTGAGACTGGATGTGGGG - Intronic
996957078 5:129196133-129196155 GCCTCCAGAAACTGGCAGGTAGG - Intergenic
997004630 5:129803665-129803687 TCCTCCAGTGCCTGGCTCAGCGG - Intergenic
997264864 5:132489698-132489720 TCCTCCAGAGACTGGCTGGGAGG - Intronic
997415136 5:133722311-133722333 TCTTCCACAGACTGGGTGGTGGG - Intergenic
997962765 5:138335203-138335225 CCCTGCAGAGGCTGGCTGGGAGG - Intronic
998142647 5:139709033-139709055 TCATCCAGAGCCTCCCTGGGAGG - Intergenic
999182733 5:149681328-149681350 TCTTCCAGAGCCAGGGTGGGGGG - Intergenic
999267353 5:150275562-150275584 TCCCCCAGTCACTAGCTGGGTGG - Intronic
1000035851 5:157447383-157447405 TCCGCCTGGCACTGGCTGGGCGG + Intronic
1000210477 5:159102797-159102819 TCCTGGAGAGACTGGCTCTGGGG - Intergenic
1001203829 5:169743648-169743670 TCCTCCATATACTTGCTGTGTGG - Intronic
1002839488 6:893764-893786 GCCTCCAGAGACTCACTGTGGGG - Intergenic
1003371430 6:5531203-5531225 TTTTCCAGTGACTGGCTGAGGGG - Intronic
1003583830 6:7367683-7367705 TCCTCTACAGGCTGGCTAGGAGG + Intronic
1005369471 6:25115857-25115879 ACCTCCAGAGCATGGGTGGGAGG + Intergenic
1006934858 6:37710220-37710242 TCCTCCACAGCCTGGCTGGGTGG - Intergenic
1007052325 6:38844803-38844825 TCCAGCAGAGACTCTCTGGGAGG - Intronic
1007074216 6:39056529-39056551 TCCTCCAGAAGTTGGTTGGGTGG - Intronic
1007324389 6:41048949-41048971 GCCTGCAGAGACAGGCTGGGAGG + Intronic
1007913708 6:45540804-45540826 ACACCCAGATACTGGCTGGGAGG + Intronic
1008302031 6:49853111-49853133 TCCTCTAGAGACTGTCTCTGTGG + Intronic
1011601179 6:89061699-89061721 TACTCAAGAGGCTGGGTGGGAGG + Intergenic
1014231493 6:118907942-118907964 TGGTCCAAAGACTGTCTGGGAGG - Exonic
1015479955 6:133698108-133698130 CCCTCCAGATTCTGGCAGGGGGG + Intergenic
1017362681 6:153594681-153594703 TTCTCCACAGAATGGCTGTGGGG + Intergenic
1018967396 6:168499186-168499208 ACCCCCAGAGACTGGCTTGTAGG - Intronic
1019356447 7:582417-582439 TCCTCCAAAAAGTGGCTGGCGGG - Intronic
1021082925 7:16384794-16384816 TCCTCCAGGGATGGGGTGGGAGG + Intronic
1021122611 7:16814223-16814245 TCATCCAGATACTGTCTGAGAGG - Intronic
1022324776 7:29321374-29321396 TCCTTCAGAGGATGGCTGTGAGG - Intronic
1022552714 7:31256653-31256675 AGCTCCAGAGACTGCCTGGGAGG - Intergenic
1024429461 7:49269401-49269423 ACCTCCTGAGACTGGGAGGGAGG + Intergenic
1026890319 7:73977840-73977862 TCCTCAAGAGACAGGCTGGAGGG + Intergenic
1027419057 7:78002412-78002434 TCCTCTAGAAACTGCCTTGGGGG - Intergenic
1028732186 7:94164116-94164138 TCCGCCAGAGGCTGACTGAGTGG + Intergenic
1029736898 7:102470027-102470049 TCCTCCAGAGCCTGGCAGAAAGG - Intronic
1030115329 7:106058517-106058539 TCCTCCAGACACAGGCTCTGAGG + Intergenic
1030286942 7:107836796-107836818 TCCTTCAGAGACCATCTGGGTGG - Intergenic
1032869133 7:135962712-135962734 TCCTCCACAGTGTGGCTTGGTGG + Intronic
1034270691 7:149802265-149802287 TCCTGAGGAGACTGGGTGGGGGG - Intergenic
1034553209 7:151834042-151834064 TCCTCCAGAAACTGGCAGTAAGG - Intronic
1035199300 7:157250113-157250135 AGTTCCAGAGACTGGCCGGGAGG + Intronic
1035980357 8:4363466-4363488 TCCTCCAGAGAGGGGGTGGTGGG - Intronic
1036772903 8:11591428-11591450 ATCTCCACATACTGGCTGGGTGG + Intergenic
1036804507 8:11820668-11820690 GCCTCCAGTGCCTGGCTCGGGGG - Intronic
1037623464 8:20587590-20587612 TCCTACAGAGACAGGGTGGGGGG + Intergenic
1040483830 8:47851835-47851857 TGCTGCAGAGCCTGTCTGGGTGG - Intronic
1041040997 8:53845508-53845530 TCTTCCACAGACAGGGTGGGAGG - Intergenic
1041694736 8:60723981-60724003 TCTGCCACTGACTGGCTGGGTGG + Intronic
1042176357 8:66040542-66040564 TCCTCTAGAGAGTTGCTGGTCGG + Intronic
1046515819 8:115259026-115259048 TCCTCCAAAGGCTGGCTAGGGGG - Intergenic
1047011874 8:120681490-120681512 ACCTCCAGAGACAGGGTAGGGGG + Intronic
1049189163 8:141277056-141277078 TCCTTCAGAGCCTGGCTCGCAGG - Intronic
1051251416 9:15162400-15162422 TCCTGAAGAGACTTGATGGGAGG - Intergenic
1051308793 9:15746946-15746968 CTCTCCAGTGACTGGCTCGGCGG + Intronic
1052746686 9:32448476-32448498 CCCTCCAGTGCCTGGCTTGGTGG - Intronic
1053463380 9:38287871-38287893 CCCTCCTCAGACTGGTTGGGGGG + Intergenic
1053519321 9:38762284-38762306 GTCTCCAGAGAGGGGCTGGGTGG + Intergenic
1056443696 9:86644528-86644550 TCCTCCCAAGGCTGGCTGGCTGG + Intergenic
1056756444 9:89384987-89385009 TCCTACAGAGACAGGCGGGTCGG + Intronic
1058178701 9:101769666-101769688 TCCTAAAGAAACTGGCTGGCAGG + Intergenic
1058574786 9:106388969-106388991 TCCACCACAGACTGACTCGGTGG - Intergenic
1061081506 9:128373509-128373531 TCCTCCAGAGACCCTCTGGAAGG + Intronic
1061423501 9:130484968-130484990 CCCTCCGGAGGCTGCCTGGGAGG + Intronic
1061631151 9:131872937-131872959 TGCTCCAAAGTCTGGCTGAGCGG - Intronic
1061780735 9:132994769-132994791 TCCTCCAGTGAGTGGGTGTGTGG + Intergenic
1062341087 9:136094359-136094381 TCCCCCAGAGCCTGGCAGAGGGG + Intronic
1062356754 9:136168559-136168581 AGCTCCAGAGACCGGCAGGGGGG - Intergenic
1062521974 9:136961706-136961728 TCATCCAGGGACTGAGTGGGCGG + Intergenic
1062599147 9:137312269-137312291 ACCCCCAGAGCCTGACTGGGAGG + Intronic
1185888905 X:3806950-3806972 TCCTCCAGAGCATTGCTGCGTGG + Intergenic
1186410526 X:9342066-9342088 TCCTCCGGAAAGAGGCTGGGTGG + Intergenic
1187397048 X:18927854-18927876 TCCTACAGAGAGTGGCTGCTGGG - Intronic
1190726631 X:53194364-53194386 CCCTGCAGAGACTGCCTGTGCGG - Exonic
1192557437 X:72101656-72101678 TCCTCCTGTGGCTGCCTGGGAGG + Intergenic
1194663482 X:96651991-96652013 TGCTCCAGAGACTGGTTAGAAGG - Intergenic
1195300910 X:103528894-103528916 TCCTCCAGATACAGCCTGGGAGG - Intergenic
1196110759 X:111944807-111944829 ACCACCAGAGACTAGCAGGGAGG + Intronic
1196960346 X:120993729-120993751 CTCTGCAGATACTGGCTGGGAGG + Intergenic
1197701148 X:129600818-129600840 GGCTCCAGAGAGTGGCTTGGGGG - Intergenic